Где собирают ладу: где и какие автомобили собирают в России :: Autonews

Содержание

где и какие автомобили собирают в России :: Autonews

C 2019 г. в России начнут собирать легковые автомобили Mercedes. Предприятие построят в индустриальном парке Есипово примерно в 40 км от Москвы. На заводе, в который инвестируют не менее 250 млн евро, будут собирать седаны и кроссоверы Е-класса. Завод станет семнадцатым предприятием России, где массово выпускают легковушки. По случаю Autonews.ru составил карту крупнейших автозаводов страны, с конвейера которых сходят иномарки.

  1. Санкт-Петербург – завод Hyundai (Hyundai Solaris, Creta; Kia Rio)
  2. Санкт-Петербург – завод Nissan (Nissan X-Trail, Murano, Pathfinder и Qashqai)
  3. Санкт-Петербург – завод Toyota (Toyota RAV4 и Camry)
  4. Санкт-Петербург – завод General Motors (Законсервирован)
  5. Всеволожск – Ford-Sollers (Ford Focus, Mondeo)
  6. Калининград – «Автотор» (Kia cee’d, Sportage, Soul, Venga, Optima, Quoris, Prime, Mohave, Cerato, Sorento; Hyundai, i40, Elantra; BMW X3, X4, X5, X6)
  7. Москва – Renault (Renault Duster, Kaptur; Nissan Terrano)
  8. Калуга – Volkswagen (VW Polo, Tiguan, Touareg, Multivan; Skoda Rapid; Audi A6, A8)
  9. Калуга – Peugeot Citroen Mitsubishi Automotive (Mitsubishi Outlander; Peugeot 408; Citroen C4)
  10. Нижний Новгород – ГАЗ (Volkswagen Jetta; Skoda Octavia и Yeti)
  11. Черкесск – Derways (Lifan Breez, Solano, Smily; Haima 3; Geely MK, MK Cross, Emgrand; Great Wall Hover; Chery Tiggo 5 и Chery Tiggo 3)
  12. Тольятти – АвтоВАЗ (Renault Logan, Sandero; Nissan Almera)
  13. Набережные Челны — Ford-Sollers (Ford Fiesta, EcoSport)
  14. Елабуга – Ford-Sollers (Ford Kuga, Explorer, Transit)
  15. Ижевск – «ИжАвто» (Nissan Sentra)
  16. Владивосток – Sollers (Toyota Land Cruiser Prado; Mazda6 и CX-5)

Как собирают Lada Granta. ВИДЕО :: Autonews

Пусть АвтоВАЗ не слишком стремительно меняет свой модельный ряд, но зато современные информационные технологии осваивает с удовольствием. Lada Granta и Kalina можно не только заказать через Интернет, но и наблюдать через веб-камеру за работой сборочного цеха завода, где собираются седаны Granta.

На сайте «Веб-выборы 2012» стартовала видеотрансляция с различных интересных и известных мест России, в том числе можно посмотреть «прямой эфир» из цеха АвтоВАЗа, где собирают автомобили Lada Granta и Kalina. На страницу трансляции можно войти с помощью учетной записи в одной из социальных сетей или зарегистрироваться. Пока лишь до 17 мая – камеры подключили на время работы выставки «Связь-Экспокомм». Но если трансляции будут пользоваться интересом, то их продолжат на постоянной основе.

Онлайн-систему приема заказов на автомобили Lada АвтоВАЗ запустил в середине апреля. Через сайт lada-direct.ru можно заказывать Granta и Kalina, а в дальнейшем планируется также сделать возможным виртуальный заказ на весь модельный ряд завода. При регистрации на сайте нужно сообщить свои персональные данные: ФИО, номер мобильного телефона, адрес электронной почты. Через сайт можно выбрать модель, вариант исполнения, комплектацию и окрас кузова. Далее пользователю предлагается определить, у какого дилера ему будет удобнее всего забрать автомобиль. После формирования заказа на почту придет письмо со ссылкой, которую нужно активировать в течение 60 минут для подтверждения заказа.

После оформления заказа клиенту нужно приехать в выбранный автосалон в течение пяти дней для заключения предварительного договора купли-продажи.

Как только заказанный автомобиль сойдет с конвейера, система заказа отправит будущему владельцу уведомление о сроках поставки авто дилеру, а после поступления автомобиля в салон заказчик получит приглашение для оформления покупки. До этого момента статус заявки можно проверять через «Личный кабинет» на сайте.

Первые Lada Granta, доступные для заказа через Интернет, раскупили буквально за несколько часов. Это было вызвано прежде всего тем, что сделав заказ онлайн, потенциальный владелец бюджетного российского седана защищал себя от возможного дальнейшего повышения цен на модель. Поэтому на какое-то время Granta исчезла из «виртуального автосалона», а сейчас АвтоВАЗ объявляет о возобновлении заказов – оставить заявку можно на автомобиль, производство которого намечено на июль 2012 года.

Светлана Алеева

Как собирают LADA в Тольятти? Репортаж

Наш Ким Коршунов побывал на заводе «АвтоВАЗ» в городе Тольятти. Как там собирают «Лады»? Ответ в нашем репортаже!

Видео:

 

Всего на заводе работает 36 000 человек. Любопытный факт — соотношение мужчин и женщин составляет примерно 50/50.

Производство автомобиля начинается с рулона российской оцинкованной стали. Из них изготавливаются разнообразные детали — капоты, двери, багажники и так далее. Один из автоматизированных прессов способен изготавливать 12,5 дверей в минуту.

Что касается сборки двигателей, то над ними трудятся 37 операторов. Основную работу, разумеется, выполняют роботы. Перед первым пуском собранного двигателя, в него заливают 5,1 литра масла — этого хватит на первые 15 000 километров.

На этом заводе собирают не только «ВАЗовские» двигатели, но и Nissan и Renault. Финальный этап — горячий запуск. На заводе проверяют 100% изготавливаемый двигателей. Для этого подсоединяются шланги, заливается масло, бензин и двигатель тестируется в течение пяти минут.

В сварочно-кузовном цехе при помощи специальных клещей рабочие занимаются сваркой всех деталей в финальный корпус будущего автомобиля. После установки крыши в дело вступают роботы — они работают с теми местами, куда людям проблематично подлезть.

Далее измеряется точность установки дверей — зазоры, мягкость открытия и закрытия должны соответствовать стандартам. Затем проверяется и весь остальной кузов на предмет зазоров и дефектов.

Между разными этапами сборки будущие автомобили перемещаются между цехами на втором этаже при помощи роботизированных платформ.

После сборки и покраски кузова устанавливается электроника, шумоизоляционные элементы и приборная панель. По умолчанию все выпускаемые машины проходят антикоррозийную обработку и дополнительно ее делать уже не нужно.

Потом начинается «свадьбы» — так называют установку силового агрегата в автомобиль. Далее рабочие устанавливают тормоза, стекла и сиденья.

На финальном этапе в машину, сошедшую с конвейера, садится человек и едет на испытания. После их прохождения автомобиль уже отправляется на продажу.

АвтоВАЗ не заметит ухода Datsun – Бизнес – Коммерсантъ

Возможное решение концерна Nissan по отказу от производства бюджетной марки Datsun в России не повлияет на загрузку завода АвтоВАЗ в Тольятти, где они выпускаются, считают аналитики и собеседники “Ъ” на рынке. По данным Reuters, Datsun якобы поглощает продажи Nissan на ряде рынков, но в РФ марка конкурирует только с моделями Lada и собирается на ее платформе. В случае сворачивания бренда АвтоВАЗ заместит ее продажи. При этом сам Nissan в РФ также не чувствует себя комфортно: продажи падают, на рынке говорят о короткой модельной линейке, в расширение которой, по словам источников “Ъ”, головной офис не готов инвестировать.

Nissan готовится к значительному сокращению мощностей на небольших для себя рынках, чтобы сосредоточить усилия на продажах в США и Китае, сообщило агентство Reuters со ссылкой на источники. В рамках «плана по восстановлению» японский автоконцерн намерен резко отойти от стратегии, заданной бывшим главой альянса Renault-Nissan-Mitsubishi Карлосом Гоном и предусматривающей массовую экспансию бизнеса.

По данным агентства, в частности, Nissan может отказаться от нерентабельных продуктов — некоторых модификаций пикапа Titan, а также закрыть недозагруженные производственные линии. Последнее, по словам собеседников Reuters, видимо, сильнее всего ударит по заводам на развивающихся рынках, собирающим автомобили под маркой Datsun и другие малолитражные машины.

Сокращение мощностей может затронуть все рынки, где собираются автомобили, за исключением Китая, хотя речь не идет о закрытии целых заводов или выводе производств из страны.

В целом концерн планирует сосредоточиться на США и Китае. В США, согласно плану, Nissan откажется от практики наращивания доли рынка за счет продажи автомобилей в автопарки, в том числе аренды, с большими скидками, что влияло на прибыльность и имидж концерна.

Nissan в 1981 году ликвидировал бренд Datsun ради продвижения собственной марки, но в 2013 году Карлос Гон представил в Индии новый автомобиль под этой маркой. Datsun с 2014 года выпускает автомобили в Индии, Индонезии, России, также они представлены в Южной Африке. Производство Datsun в России идет на АвтоВАЗе на платформе Kalina (сейчас там также производится Granta). Модели разрабатывались индивидуально для каждого рынка.

Источники Reuters говорят, что у Nissan возникли проблемы после развертывания Datsun, в частности, в Индонезии, где те стали поглощать продажи Nissan.

В России в линейке Datsun представлены только седан on-DO и хетчбэк mi-DO, которые фактически представляют собой перелицованные модели Lada, тогда как в других регионах присутствия марки также продается кроссовер.

Ценовое позиционирование Datsun в России такое, что не мешает продажам Nissan или даже Renault и новых моделей Lada, сказал “Ъ” глава ассоциации «Российские автомобильные дилеры» (РОАД) Олег Мосеев. Возможность объединить Datsun и Nissan под одним брендом он оценивает скептически, вспоминая опыт Renault: тот стал продавать в России в отличие от Европы модели Dacia Logan, Duster и Sandero как Renault, что изменило позиционирование марки на рынке как низкобюджетной. Владимир Беспалов из «ВТБ Капитал» также не видит смысла в объединении марок на российском рынке, в частности, говоря о том, что в России сильно представление о Nissan как более дорогом бренде.

В российском офисе Nissan назвали тему спекуляцией и отказались от комментариев. В АвтоВАЗе возможное сворачивание сборки Datsun также не комментируют. Правда, отмечают источники “Ъ”, с учетом того, что на том же конвейере производится Lada Granta, продажи которой, по данным АЕБ, в январе-сентябре составили почти 97 тыс. машин, закрытие сборки Datsun с реализацией в 16,5 тыс. машин за тот же период не окажет эффекта на АвтоВАЗ.

Но проблемы у Datsun в России есть, полагают собеседники “Ъ”, и связаны они с ограниченной модельной линейкой, однако их не избежал и сам Nissan. По словам одного из источников “Ъ”, по сути, у Nissan после отказа от седанов и ухода внедорожника Patrol в 2017 году остались лишь две продаваемые модели и две нишевые.

По мнению собеседника “Ъ”, в целом будущее Nissan в России остается неопределенным: российское представительство понимает проблемы с ограниченным модельным рядом, но в условиях падающего рынка производитель не намерен направлять в РФ значительные инвестиции.

У Nissan есть завод в Петербурге мощностью в 100 тыс. машин в год, где выпускаются модели Nissan Qashqai, X-Trail, Murano. В 2018 году производство на нем выросло на 23%, но осталось недозагруженным — было выпущено только 56,5 тыс. машин. При этом, как сообщал “Ъ” 4 февраля, Nissan в альянсе с Mitsubishi и Renault стал привлеченной стороной в специнвестконтракте АвтоВАЗа. Mitsubishi в последние годы обеспечивал основную загрузку калужского завода ООО ПСМА (70% у PSA, 30% у Mitsubishi). После окончания жизненного цикла производимых моделей Mitsubishi может покинуть калужское производство — примерно в 2022 году, перейдя на площадки альянса, в том числе и Nissan. Доля Nissan на российском авторынке в январе-сентябре упала на 0,7 процентного пункта, до 3,8%, Datsun — выросла на 0,2 процентного пункта, до 1,3%. Продажи Nissan за тот же период упали на 16%, до 48,7 тыс. штук.

Владимир Беспалов полагает, что для Nissan Россия сегодня не находится в фокусе. Если же будет принято стратегическое решение по отказу от производства Datsun, то модели Lada вполне смогут заместить этот объем, говорит аналитик.

Ольга Никитина


Какие страны собирают российские автомобили? | Об автомобилях | Авто

В 2018 г. количество стран, выпускающих машины под марками «АвтоВАЗа», ГАЗа, УАЗа и КамАЗа, увеличилось до семи. В новом году их круг должен расшириться.

«Больше всего примеров сотрудничества с Казахстаном, — сообщил „АиФ“ начальник аналитического центра компании „АСМ-холдинг“ Василий Сеин. — Группа „ГАЗ“ выпускает здесь спецтехнику на базе шасси грузовиков „Урал“, автобусов ПАЗ и ЛиАЗ. „АвтоВАЗ“ собирает автомобили LADA. УАЗ производит внедорожники „Патриот“ и „Хантер“, автобусы и грузовики. И еще в 2005 г. создал совместное предприятие с казахстанским партнером КамАЗ. 

Вместе с КамАЗом организовали производство также Индия, Иордания и Узбекистан, вместе с „АвтоВАЗом“ — Египет. А ГАЗ выпускает легкие коммерческие автомобили в Турции и — с октября 2018 г. — грузовики на Кубе». 

В Казахстане по итогам 9 месяцев 2018 г. автомобили бренда LADA вышли на первое место по продажам с долей рынка 22,9%. При этом «АвтоВАЗ» продает в этой стране только автомобили, которые собраны на заводе в Усть-Каменогорске, принадлежащем казахстанской компании «Азия Авто». Серийное производство на нем началось еще в 2003 г. со сборки легендарной «Нивы» (LADA 4×4). И сегодня волжское предприятие выпускает на этой площадке весь свой модельный ряд. 

Со временем здесь же, в Усть-Каменогорске, начал сборку УАЗ. В 2019 г. он планирует поставить на завод «Азия Авто» компоненты для 1800 автомобилей. Это почти 4% от общего объёма машин, выпускаемых под марками УАЗа. Кроме того, сейчас эта компания ведёт переговоры с об организации производства своих автомобилей в Узбекистане.

С 2013 г. на заводе «СемАЗ» в Семипалатинске идет лицензионная сборка «Уралов» из готовых машинокомплектов. Здесь также созданы мощности для выпуска легких коммерческих автомобилей «ГАЗель NEXT» и «ГАЗель БИЗНЕС». 

Сборочная площадка ГАЗа в Турции была открыта в 2012 г. в городе Сакарии. Сегодня на ее конвейере собирают 8 модификаций автомобиля «ГАЗель NEXT». 

Среди новых зарубежных проектов, которые готовит ГАЗ, — старт производства в Азербайджане, намеченный на конец 2019 г. На первом этапе совместно с компанией «Азермаш» планируется выпускать автомобили семейств «ГАЗель» и «Соболь», а также среднетоннажный грузовик «ГАЗон NEXT». На втором этапе начнется сборка автобусов «Вектор NEXT» и ЛиАЗ.

Смотрите также:

АЗИЯ АВТО намерен приступить к производству LADA Vesta SW Cross и LADA Vesta SW

Казахстанский автосборочный завод «АЗИЯ АВТО» намерен приступить к производству новых модификаций одного из самых востребованных автомобилей на казахстанском рынке — LADA Vesta. Версии Vesta SW Cross и Vesta SW поступят в продажу в 2018 году. Новые модели гармонично сочетают экспрессивный дизайн с эффектным внутрисалонным пространством, выводя на новый уровень комфорт и функциональность, не только в семействе LADA Vesta, но и в своем сегменте.

Основные черты в дизайне кузова LADA Vesta SW Cross унаследовал от концепт-кара Cross Concept, представленного на Международной выставке внедорожников, кроссоверов и вездеходов «Moscow Off-Road Show» в 2015 году. Автомобиль несет в себе философию «ИКС-образного» дизайна, являющегося частью ДНК Марки. LADA Vesta SW Cross продолжает стратегию по разработке новых продуктов, учитывающую самые актуальные запросы потенциальных клиентов.

По словам директора LADA Design Стива Маттина, LADA Vesta SW Cross станет уникальным предложением и призван задать тон в своем сегменте, ломая стереотипы и привлекая новых покупателей, традиционно пользовавшихся автомобилями с другими типами кузова, такими как хэтчбэк и кроссовер.

LADA Vesta SW Cross и LADA Vesta SW являются примером динамичного развития марки. Увеличенная функциональность в совокупности с уверенным и спортивным внешним видом, интерпретированным через генетический код «ИКС-образного» дизайна, создают достойное пополнение модельного ряда LADA Vesta и закладывают базу для дальнейшего развития портфолио бренда.

Тонкости дизайна

LADA Vesta SW Cross и LADA Vesta SW созданы на основе одного типа кузова, однако каждый из автомобилей имеет свой индивидуальный дизайн и ярко-выраженный характер.

Обе модели выглядят по-спортивному. LADA Vesta SW — динамичная и одновременно сбалансированная — несет в себе дополнительную полезную функциональность благодаря большому внутреннему объему и наличию пятой двери.

LADA Vesta SW Cross, в свою очередь, добавляет семейству еще больше практичности за счет увеличенного дорожного просвета и наличию защитных элементов кузова, придающих модели мощный и внушительный вид.

Передняя часть LADA Vesta SW несет отпечаток ярко-выраженной ИКС-графики, в то время как LADA Vesta SW Cross получила в дополнение к ней более мощный и экспрессивный характер. Темные грани передних фар плавно переходят в решетку радиатора и расположенный под ней воздухозаборник, принимая графическую форму ИКС. У LADA Vesta SW Cross линия продолжается до нижней части бампера, что визуально увеличивает размер ИКС-графики в передней части автомобиля, контрастируя с цветом капота, передних крыльев и бампером. Графическое решение также подчеркивается расположенной по центру защитной накладкой серебристого цвета, объединяющей между собой два декоративных хромированных «бумеранга», что в очередной раз свидетельствует о принадлежности к ДНК марки. Внешний вид переднего бампера в комплексе с накладками на арки передних колес зрительно увеличивают автомобиль, придавая ему сильный и уверенный облик.

Покатая линия крыши переходит в интегрированный задний спойлер, улучшающий аэродинамику и повышающий сцепление с дорогой. Особый наклон элементов остекления в задней части автомобиля и оригинальные задние стойки формируют оптическое впечатление парящей крыши. Расположенные на ней рейлинги придают силуэту спортивности: на LADA Vesta SW Cross они серебристого цвета.

Форма задней стойки автомобиля напоминает «акулий плавник» и придает машине свежесть и уникальность. Кромка задних стоек выровнена относительно угла наклона линии задних фонарей, а глянцевая черная вставка отделяет заднюю стойку от крыши и заднего спойлера, поддерживая идею «парящей крыши». Подобное решение служит и для разделения потоков воздуха по бокам автомобиля, улучшая аэродинамику. В совокупности с двухсекционными задними фонарями это решение вносит элемент эмоциональности в облик задней части автомобиля, визуально расширяя его и придавая устойчивости посадке, а двойной хромированный патрубок выхлопной трубы добавляет внешнему виду спортивности. Тема «акульего плавника» появляется и в интегрированной в крышу антенне, расположенной перед задним спойлером.

Внушительный внешний вид LADA Vesta SW Cross подчеркивают широкая колея и шины большей размерности на дисках оригинального дизайна, 5 спиц которых выполнены в форме клинка с алмазной огранкой по внешнему контуру.

Новая философия комфорта и функциональности

Так же как и в случае с дизайном кузова, при работе над интерьером было уделено особое внимание современным трендам для создания настоящего жизненного пространства, способного с легкостью трансформироваться в зависимости от потребностей водителя и пассажиров.

При работе над LADA Vesta SW Cross стояла цель создать более спортивный интерьер под стать внешнему дизайну. Поставленную задачу удалось решить за счет использования ярких оранжевых цветовых акцентов в отделке дверных панелей и обивке сидений. Подобный подход позволил гармонично сбалансировать цветовую концепцию, подчеркивающую характер автомобиля. Для любителей спокойных решений в интерьере предусмотрена отделка модного и в то же самое время благородного серого цвета. Внутрисалонное пространство LADA Vesta SW унаследовало цветовую гамму, использованную в седане. Уникальные графические решения применены на LADA Vesta SW Cross: оранжевые световые кольца опоясывают шкалы комбинации приборов, еще больше усиливая яркий характер автомобиля. Для создания интересного контраста в оформлении салона использована черная глянцевая отделка на приборной панели и ручках дверей. Охлаждаемый перчаточный ящик, объемом 14 л, на обеих моделях получил функцию плавного открывания крышки, а также интегрированный внутренний органайзер с подстаканником.

Между передними сиденьями LADA Vesta SW Cross и LADA Vesta SW расположена высокая консоль. Она служит не только в качестве подлокотника для водителя и впереди сидящего пассажира, но и предоставляет дополнительное место для хранения. В задней части консоли расположена 12-вольтовая розетка, USB-порт и кнопки подогрева задних сидений. Последняя функция на автомобилях LADA появилась впервые.

Задний ряд сидений складывается в соотношении 1/3 к 2/3, предоставляя дополнительные функциональные возможности для перевозки пассажиров и перемещения грузов. Комфорт для пассажиров на задних сиденьях обеспечивается за счет откидного центрального подлокотника с двумя подстаканниками.

Особого внимания заслуживает багажное отделение LADA Vesta SW Cross и LADA Vesta SW, доступ к которому обеспечивается за счет использования кнопки, расположенной на крышке багажника. Высота и угол открывания крышки оптимизированы для удобства использования людьми высокого роста, а две ручки с обеих сторон внутренней панели делают процесс закрывания багажного отделения особенно удобным.

Комфорт и функциональность можно почувствовать не только при нахождении внутри салона, но и при перевозке грузов. Практичный и вместительный багажник получил двойной пол, который разделен на две секции, с возможностью применения органайзера. Каждая из взаимозаменяемых секций может быть использована индивидуально или зафиксирована в вертикальном положении, предоставляя дополнительные возможности для наиболее эффективной эксплуатации багажного отделения. При необходимости увеличения объема загрузочного отсека ящики органайзера и напольные панели могут быть убраны. Под вторым полом размещено запасное колесо. На пластиковой обивке багажника расположены крючки крепления сумок, пакетов и 3 штатных сеток для фиксации грузов. Отдельного внимания заслуживают дополнительные места для хранения различных предметов багажа, значительно повышающие функциональность багажника LADA Vesta SW Cross и LADA Vesta SW. Например, расположенный в районе арки правого колеса, закрываемый специальной крышкой ящик для небольших вещей, или открытая ниша с левой стороны с ремнем, удерживающим 5-литровую канистру с жидкостью. Рядом с ней находится небольшой карман для перевозки мелких предметов. Объем багажного отделения, включая нишу, расположенную в арке правого колеса, составляет 480 л (до полки-шторки), двойной пол предоставляет еще 95 л полезного объема, а объем багажника при сложенных сиденьях второго ряда (до подоконной линии) составляет уже 825 л.

Два источника света интегрированы в боковые панели багажного отделения под сдвижной шторкой, что обеспечивает комфорт при его использовании в ночное время. В случае необходимости можно воспользоваться 12-вольтовой розеткой, находящейся на боковой панели, расположенной справа.

LADA Vesta SW Cross и LADA Vesta SW, как и седан, имеют оборудование, характерное для автомобилей более высокого класса. Так, рулевая колонка регулируется по высоте и вылету, а кресло водителя оборудовано регулировкой по высоте и поясничной поддержкой, что гарантирует комфорт для водителей любого роста и пропорций. Подогрев передних сидений снабжен трехступенчатой системой управления нагревом, климат-контроль следит за поддержанием заданной температуры, обогрев ветрового стекла помогает быстро и удобно передвигаться в зимнее время, а датчики дождя и освещенности надежно и оперативно реагируют на смену погодных условий при вождении. Бортовой компьютер LADA Vesta SW Cross и LADA Vesta SW позволит отследить расход топлива, определить время, среднюю скорость движения и другие показатели. На руле расположены кнопки управления мультимедиа-системой и круиз-контролем.

Колеса большего размера и оригинальные настройки подвесок позволили увеличить дорожный просвет LADA Vesta SW Cross до 203 мм — показатель, более привычный для сегмента классических кроссоверов. Дорожный просвет LADA Vesta SW — 178 мм. Такой клиренс достаточен практически в любой жизненной ситуации вне зависимости от степени загрузки автомобиля. Серийные автомобили также будут оснащаться наружной кнопкой открывания багажника, запираемым лючком бензобака, задними дисковыми тормозными механизмами (в некоторых комплектациях). Управляемость новых автомобилей закрепит за всем семейством LADA Vesta статус лидера сегмента по этому показателю — кузова новинок усилены дополнительными элементами, повышающими жесткость на кручение, а в меру острое рулевое управление (2,8 оборота руля) подарит новые ощущения от вождения.

Габариты автомобилей
LADA Vesta SW
Длина 4.410 мм
Ширина 1.764 мм (по кузову)
Высота 1.512 мм (по крыше с рейлингами)
Колесная база 2.635 мм
Клиренс 178 мм
LADA Vesta SW Cross
Длина 4.424 мм
Ширина 1.785 мм (по кузову)
Высота 1.532 мм (по крыше с рейлингами)
Колесная база 2.635 мм
Клиренс 203 мм

Где выпускают Лада Веста

Сборка кузова Лада Веста
Собранная Лада Веста на заводе

К сегодняшнему моменту конструкторы АвтоВАЗа неожиданно часто стали радовать отечественных владельцев новыми моделями машин. Еще в недавнем прошлом приходилось горько сожалеть о том, что на родине такой скудный выпуск автомобилей. Новинкой, о которой идет уже много разговоров, стала Лада Веста. Эта машина вбирает в себя все лучшие идеи иностранных аналогов. Создатели растут в профессионализме вместе со своим детищем. «Где выпускают Лада Веста на территории РФ?» – такой вопрос вполне уместен среди обывателей.

Когда началось производство, его особенности

В сентябре 2015 года стартовал процесс изготовления автомобиля Лада Веста. Спустя два месяца продукт выпускают в продажу. Сначала модель рассматривалась как очередной провал, но сегодня Лада Веста раскупается довольно крупными партиями наравне с некоторыми иномарками. К преимуществам автомобиля относят:

  1. Доступную и разумную цену.
  2. Комфортабельные условия нахождения внутри.
  3. Привлекательный внешний вид и достаточную вместительность.
  4. Штатная сборка теперь включает ESP и ABS.
  5. Наличие двух подушек безопасности.

Новую Лада Веста седан собирают и выпускают в Ижевске, где производят лифтбек Лада Гранта. Инженеры «Рено» помогали в разработке кузова, который проектировался на основе новейшего программного обеспечения. Каркас автомобиля не уступает в крепкости Ford Focus. Это было доказано уже на первых краш-тестах.

Сборка кузова и покраска Лада Веста

Сборка кузова Лада Веста
Основная работа по свариванию деталей автомобиля предоставлена роботизированной точной аппаратуре. Однако без человеческого присутствия невозможно здесь обойтись. Там, где собирают Лада Веста, каждый этап конвейера обусловлен действиями рабочих. Они старательно и точно прикладывают деталь на нужное место. Рабочие же подносят оборудование на области, которые будут сварены.

Покраска, которая в прошлом вызывала большое негодование покупателей, теперь повышает собственное качество. Работая с иностранными компаниями, которые выпускают лучшие продукты машиностроения, ижевская автопромышленность приобретает новые материалы и технологические инновации. Сначала кузов окунают в ванну со специфическим раствором, а после используют катафарезный грунт. Большую часть процесса выполняет автоматика, но обычные маляры необходимы, чтобы сделать работу там, где неуклюжая техника не может развернуться.

Финальный этюд сборки

Собранная Лада Веста на заводе
  1. Каждый работник, ответственный за производство любой мелкой детали автомобиля, должен профессионально подойти к делу, а мастера — внимательно проследить за процессом.
  2. Создатели Лада Веста позаботились о том, чтобы повысить комфорт в салоне, используя изоляционные материалы против шума и вибрации не только на днище и моторе, но даже на крыше.
  3. Финальный этап сборки там, где производят Лада Веста, практически не отличается от аналогичного процесса у иномарок. После покраски убирают двери, которые идут в цех доработки. Без них намного проще собирать салон. Поставив передние фары и бампер с радиатором, соединение оканчивают состыковкой с ходовой частью и силовым агрегатом.

Делают Лада Веста, по большей части, основываясь на опыте иностранных профессионалов с использованием роботизированной техники, которая чрезвычайно помогает собрать качественный продукт. Автоконцерн планирует производство не только седанов, но и «универсал», а также «хэтчбек». Расширенный модельный ряд поможет приблизиться к запланированному на 2017 год количеству произведенных транспортных средств.

Многие интересовались, на каком заводе, кроме «ИжАвто», будут выполняться сборочные работы. В России этим местом будет «ЧеченАвто» в городе Аргун. Усть-Каменогорский «БипэкАВто» на казахстанской земле также возьмется за сборку Лада Веста. Таким образом, город Ижевск не останется единственным представителем сборочного процесса этой модели, способный выпускать продукцию от АвтоВАЗа.

Что такое лад на гитаре

Поддерживается Red Diamond Audio. Когда вы совершаете покупку по ссылкам на нашем сайте, Мы можем получать партнерскую комиссию. Прочтите ПАРТНЕРСКОЕ РАСКРЫТИЕ.

Лады — это, по сути, тонкие металлические полоски, закрепленные на той стороне шеи гитары, где находятся ее струны. Они используются для обозначения места ноты, сыгранной на гитаре. Однако области между двумя полосами также обычно называют ладами.

Лады расположены по длине шеи гитары и в начале ее корпуса.Последовательные лады поднимают ранее сыгранную ноту на полтона. Поскольку на грифе гитары 12 ладов, гитаристы могут играть всю гамму, начиная с игры на открытой струне и заканчивая нажатием на двенадцатый лад.

Игроки могут играть на одном из ладов, прижимая струну к гитаре в этом месте. Это уменьшает вибрирующую длину струны до длины между мостом и ладом рядом с тем, на который прижимается и между ним и мостом.Математика, лежащая в основе размера лада и его расстояния от моста, гарантирует, что соотношение расстояний двух последовательных ладов всегда будет одинаковым. Так устроены лады для работы на большинстве современных гитар. Это делает интонацию гитары ровной. Другими словами, это означает, что каждый лад производит полутон при нажатии на струну. Однако есть много инструментов с неодинаковым темперированием.

Рекомендуемое чтение: Сколько стоит установка для гитары

Гитары обычно ладят фанатскими ладами.Эти лады параллельны друг другу и перпендикулярны грифу гитары. Однако используются и другие ладовые установки. У одного из них есть зубчатые лады. Гриф становится зубчатым, когда вся или часть дерева между ладом удалена. Это может помочь игрокам легче сгибать или вибрировать струну, потому что струна не касается шеи гитары. Помимо веерных и зубчатых ладов есть еще и толстые лады. Эти лады намеренно шире, чтобы они могли изменять изгиб и служить дольше.

Есть определенные проблемы, связанные с гитарными ладами. Одна из них заключается в том, что лады начинают изнашиваться, когда игроки используют гитару в течение длительного времени. В большинстве случаев гитара нуждается в накладке ладов, что означает, что лады необходимо отполировать и вернуть в исходное положение в случае смещения. Однако, если они не подлежат ремонту, лады придется заменить на новые.

Изношенные лады могут вызывать жужжание лада или нежелательный жужжащий звук, который возникает при нажатии струны на лад.Это происходит, когда лады изношены или порваны, и обычно их легко исправить. Однако жужжание может быть специально добавлено во время игры.

Лады

служат наилучшим образом, когда гитара устанавливается, гайка и натяжение струн правильно отрегулированы. Игроки решают, как лучше всего расположить и манипулировать этими элементами. Это помогает им добиться желаемого звукового эффекта. Также важно правильно ухаживать за гитарой, чтобы не повредить лад.

Отъезд: лучшие акустические гитары

Кодирование нескольких виртуальных сигналов в штрих-кодах ДНК с помощью одной молекулы FRET

РЕФЕРАТ

Штрих-кодирование ДНК позволяет маркировать огромное количество различных биологических молекул с использованием исключительной программируемости в синтезе последовательностей ДНК.Флуоресцентная визуализация — это простой в доступе метод обнаружения отдельных штрих-кодов ДНК, который можно масштабировать до формата с высокой пропускной способностью. Однако большое перекрытие между спектрами излучения флуоресцентных красителей сильно ограничивает количество штрих-кодов ДНК — и, следовательно, ее сигнальное пространство, — которые могут быть обнаружены одновременно. Здесь мы демонстрируем использование резонансной передачи энергии флуоресценции одиночных молекул (FRET) для кодирования виртуальных сигналов в штрих-кодах ДНК с использованием стандартной двухцветной флуоресцентной микроскопии.Оптимизируя визуализацию и условия биохимии для событий слабой гибридизации для штрих-кодов ДНК, мы заметно повысили точность определения эффективности, с которой происходит FRET одной молекулы. Это позволило нам однозначно дифференцировать шесть штрих-кодов ДНК, показывающих разные значения FRET, без обмена последовательностями зондов. Наш метод может быть напрямую интегрирован с предыдущими методами штрих-кода ДНК и, таким образом, может быть широко принят для расширения сигнального пространства методов штрих-кода ДНК.

ДНК, основной материал, выбранный биологическими системами для передачи и сохранения своей генетической информации, демонстрирует замечательный уровень химической стабильности и механической жесткости. 1–3 . ДНК проявляет высокую специфичность в гибридизации с образованием спиральной двухцепочечной структуры. Вставка одного несоответствия в идеально совпадающие последовательности из 20 нуклеотидов, как сообщается, ослабляет силу гибридизации до десяти раз 4, 5 .

Эта высокая специфичность в гибридизации ДНК находит свое прекрасное применение во многих различных областях нанотехнологий ДНК, одним из которых является программируемое мечение различных биологических молекул для оптического обнаружения 6, 7 .По сравнению с другими методами мечения и обнаружения, такими как методы, использующие изотопы 8 и метаболиты 9 , флуоресцентное маркирование и оптическая визуализация на сегодняшний день являются легкодоступным и высокопроизводительным методом идентификации биологических молекул 10, 11 . Используя исключительную программируемость ДНК, было показано, что мириады биологических молекул помечены различными последовательностями ДНК и обнаруживаются с высокой специфичностью гибридизации ДНК.Эти технологии, в совокупности называемые штрих-кодированием ДНК, открывают способ справиться с постоянно растущей сложностью биологических молекул и исследовать их пространственно-временное распределение вплоть до уровня отдельной клетки 12–15 .

Однако относительно широкий спектр излучения флуоресцентных красителей уже затрудняет обнаружение более трех флуоресцентных красителей одновременно. 16 . Сообщается, что несколько технологий увеличивают либо пространство сигналов, охватываемое штрих-кодами ДНК, либо точность обнаружения успешных событий гибридизации ДНК.Для увеличения сигнального пространства штрих-кодов ДНК различные наборы ДНК-зондов вводятся последовательно, и паттерны связывания, наблюдаемые в ходе этих многократных циклов введения зондов, в совокупности кодируют уникальные идентичности отдельных биологических молекул 17–19 . Например, MERFISH, который идентифицирует отдельные штрих-коды ДНК по двузначным схемам связывания различных ДНК-зондов, продемонстрировал подробное картирование более тысячи геномных РНК в небольших клеточных ядрах 20 .Накопление точек ДНК для визуализации в наноразмерной топографии (DNA-PAINT) использует намеренно слабую гибридизацию ДНК-зондов, чтобы вызвать повторяющееся связывание ДНК-зондов. Была продемонстрирована заметная повышенная точность обнаружения гибридизации ДНК, поскольку повторяющееся связывание зондов DNA-PAINT увеличивало количество флуоресцентных фотонов, обнаруживаемых для отдельных целей 21 .

Кроме того, резонансный перенос энергии флуоресценции одиночных молекул (FRET) находит способы интеграции с технологиями штрих-кодирования ДНК. 22–24 .Например, показано, что одномолекулярный FRET снижает фоновый шум флуоресценции, исходящий от диффундирующих ДНК-зондов, тем самым существенно повышая эффективность обнаружения 25 . В зависимости от расстояния между донорными и акцепторными красителями, одномолекулярный FRET может происходить с разной эффективностью, и было продемонстрировано, что отдельные события гибридизации ДНК могут быть помечены низкой и высокой эффективностями FRET, замечательное изобретение, которое увеличивает глубину сигнала ДНК. штрих-кодирование в два раза 26 .Однако относительно низкие отношения сигнал / шум, полученные до сих пор, препятствовали более широкому использованию виртуальных сигнальных каналов, генерируемых одномолекулярным FRET в области штрих-кодирования ДНК.

В этой работе мы сообщаем о систематических способах повышения отношения сигнал / шум при маркировке штрих-кодов ДНК с различной эффективностью FRET для одной молекулы. В результате мы смогли продемонстрировать разделение пространства эффективности FRET на шесть виртуальных каналов. Учитывая, что предыдущая демонстрация современного состояния, которая просто разделила пространство FRET на состояния с низким и высоким FRET, наши результаты представляют дальнейшее расширение сигнального пространства технологии штрих-кода ДНК в три раза.Мы отмечаем, что нынешнее расширение сигнального пространства можно легко комбинировать с другими технологиями штрих-кодирования ДНК, не требуя сложных инструментов.

Ключевым принципом нашей разработки для создания нескольких виртуальных каналов FRET является обнаружение отдельных штрих-кодов FRET с временной дифференциацией. С этой целью мы сознательно ослабили взаимодействие между штрих-кодом и последовательностями зондов. Было показано, что эти слабые взаимодействия делают единичные события гибридизации в значительной степени временными, что дает возможность поиска других последовательностей штрих-кода с помощью последовательностей зондов.Это позволяет проявлять различную эффективность FRET, кодируемую отдельными штрих-кодами во временной области. Таким образом, мы считали точное обнаружение FRET во время переходных событий гибридизации первым шагом к достижению нашей цели.

Чтобы проверить эту возможность, мы сконструировали гибридную структуру ДНК, в которой штрих-код FRET был закодирован в одноцепочечном (ss) выступе ( Fig. 1a ). Эта последовательность штрих-кода содержит сайты связывания для двух коротких участков оцДНК, меченных красителями Cy3- и Cy5, каждый (в дальнейшем называемых cy3- и cy5-зондами), так что при связывании с обоими зондами FRET индуцируется с заранее заданной эффективностью ( E ) ( Фиг.1a и Supp. Рис. 1a ). Чтобы гарантировать временное связывание зондов, мы ограничили длину связывающих последовательностей 8 и 7 нуклеотидами (нуклеотидами) для cy3- и cy5-зондов соответственно. Последовательность штрих-кодов и зондов адаптирована из консенсусных последовательностей, используемых для DNA-PAINT, и модифицирована путем обрезки концевых нуклеотидов для более быстрой кинетики связывания ( Supp. Fig. 1a ) 18 . После сборки гибридных структур ДНК на пассивированной полимером поверхности микрофлюидной камеры 27 , мы добавили в камеру как cy3-, так и cy5-зонды (каждый при 100 нМ и 500 нМ соответственно) и взяли временное разрешение. флуоресцентная визуализация на уровне отдельных молекул (временное разрешение 100 мс) ( рис.1b и Доп. Рис.2 ). Мы предположили, что повторяющееся связывание и развязывание зондов cy3 и cy5 может вызвать ступенчатые флуктуации интенсивности в определенных пространственных областях. После накопления изображений из нашей записи с временным разрешением мы, таким образом, провели поиск областей с большими стандартными отклонениями в их сигналах флуоресценции и обозначили эти области как области интересов (ROI) ( Рис. 1b-c, ).

Рис. 1. Обнаружение штрих-кода FRET одной молекулы с дифференцированной по времени.

(а) Схема гибридных комплексов ДНК для временного обнаружения FRET. (b-c) Пример временного ряда изображений флуоресценции одной молекулы и изображения стандартной интенсивности для определения области интереса флуоресценции. ROI выделены красным кружком. (d) Типичные временные кривые интенсивности флуоресценции (верхняя панель) и FRET (нижняя панель). Точки данных с высокой интенсивностью для отдельных событий связывания были выделены двуглавыми стрелками и темными цветами. (e) Гистограммы FRET событий связывания зонда из всех областей интереса в едином поле зрения.(f) Схема гибридных комплексов ДНК с тремя штрих-кодами FRET. (g) Семь различных комбинаций гибридной структуры ДНК с тремя штрих-кодами FRET. (h) Пример флуоресценции одной молекулы и временные кривые FRET, полученные из комплекса гибридной ДНК, состоящего из штрих-кода (1-я строка) [A], (2-я строка) штрих-кодов [A, B] и (3-я строка) штрих-кодов [A, B, C]. На верхних панелях показана сумма интенсивностей донора и акцепторов, которые показаны отдельно на средних панелях. Связывающие события выделены темным цветом.На нижних панелях показаны рассчитанные значения КПД FRET. (i) Распределение эффективности FRET пиков, собранных из одного поля зрения для семи различных гибридов ДНК. Сплошные линии — мультигауссовы аппроксимации. Пунктирные линии обозначают положение каждой подгруппы населения.

Временные диаграммы, извлеченные из отдельных областей интереса, действительно показали повторяющиеся ступенчатые изменения в каналах флуоресценции как cy3, так и cy5 из-за связывания соответствующих зондов ( рис. 1d, верхняя панель ).Мы также применили порог интенсивности, найденный с помощью кластеризации K-средних с 2 состояниями, чтобы идентифицировать сегменты на отдельных трассах с временным разрешением, которые демонстрируют надлежащую интенсивность флуоресценции, указывающую на связывание одиночных cy3- и cy5-зондов с последовательностью штрих-кода ( Рис. 1d. , двуглавые стрелки ). Как и ожидалось, мы наблюдали высокую эффективность FRET ( E ~ 0,8) при одновременном связывании и cy3-, и cy5-зондов, что было подтверждено на гистограмме распределения эффективности FRET, построенной из 2445 событий связывания из 176 областей интереса ( рис.1д ). Связывание только cy3-зондов проявлялось в виде другого пика при E ~ 0,1.

Поскольку мы успешно реализовали методы разрешения сигналов FRET от временных событий привязки, длящихся всего несколько секунд, мы приступили к разрешению нескольких последовательностей штрих-кодов с разными значениями FRET. Мы сконструировали подобную гибридную структуру ДНК, которая имела двухцепочечные стволовые области с выступающими выступами оцДНК, которые содержали последовательности штрих-кода ( Рис. 1f и Supp. Рис. 1b ). В частности, мы варьировали длину спейсера, состоящего из поли (тимина), между сайтами связывания cy3- и cy5-зонда для кодирования трех различных штрих-кодов FRET.

Мы приготовили семь гибридных структур ДНК с различными комбинациями последовательностей FRET-штрих-кода ( Рис. 1g ). Следуя методу, который мы разработали выше для случая одного штрих-кода FRET, мы идентифицировали области интереса и переходные события гибридизации на отдельных временных графиках ( Рис. 1h и Supp. Рис. 3 ). Сначала мы исследовали гибридную структуру со штрих-кодами A и B.

Индивидуальная трасса с временным разрешением, полученная из этой структуры, отражала две основные популяции FRET с одним пиком, расположенным в области высоких значений FRET ( E ~ 0.85), а другой посередине ( E ~ 0,6), что хорошо согласуется с короткой и промежуточной длиной спейсера 2 и 10 нт, используемой для штрих-кодов A и B, соответственно. Аналогичным образом, отдельные трассы, полученные из гибридной структуры со всеми тремя штрих-кодами (A, B и C), показали распределение FRET, которое хорошо соответствовало трем распределениям Гаусса. Наконец, когда мы построили коллективные гистограммы FRET для всех семи различных гибридных структур, мы получили различные распределения FRET, которые однозначно отражали существование определенных последовательностей штрих-кода ( Рис.1i ). Вместе эти результаты демонстрируют, что, используя только два физических канала флуоресценции, мы смогли обнаружить несколько штрих-кодов FRET в ограниченном дифракцией объеме, в частности, в схеме реакции с одним горшком, которая не требует замены буфера для различных последовательностей зондов.

Продемонстрировав успешное обнаружение трех штрих-кодов FRET, мы попытались еще больше повысить обнаруживаемую способность нашего метода. Мы обнаружили, что большое перекрытие между пиками FRET ( рис.1i ) поставили перед собой практическую задачу увеличения количества штрих-кодов, которые можно идентифицировать за одно измерение. Чтобы уменьшить неопределенность в определении эффективности FRET для каждой последовательности штрих-кода, мы систематически исследовали несколько физических факторов при визуализации одиночных молекул. Во-первых, мы заметили, что некоторые области интереса не показывали ступенчатые изменения интенсивности флуоресценции, ожидаемые для ассоциации и диссоциации одного зонда, а скорее произвольные флуктуации интенсивности или большой фоновый шум, который приводил к увеличению шума в нашем определении FRET (рис.2а-б). Мы пришли к выводу, что ассоциация и диссоциация одного зонда, описываемая кинетикой первого порядка, приводит к большему динамическому отклонению и снижению автокорреляции во временной области, чем проявляется нерегулярными флуктуациями интенсивности ненужных молекул флуоресценции. Действительно, мы обнаружили, что следы штрих-кода были четко различимы по характерным кинетическим временным шкалам, которые можно количественно оценить с помощью отклонения Аллана и значений автокорреляции (, рис. 2c-d, ). При правильном выборе времени задержки (около 1 с), которое максимально разделяет две группы, мы смогли достичь ~ 99% истинно-положительных и ~ 97% ложно-отрицательных результатов ( Рис.2д ).

Рис. 2. Экспериментальная и постэкспериментальная оптимизация точности обнаружения штрих-кода FRET.

(a, b) Примеры следов (a) сигналов штрих-кода одной молекулы и (b) нежелательных сигналов. (c-d) Различение нежелательных сигналов от сигналов штрих-кода путем проверки временной корреляции и отклонения Аллана. (c) отклонения Аллана и (d) временные корреляции для отдельных ROI были рассчитаны для различных времен запаздывания. Отдельные ROI были вручную классифицированы на штрих-коды (оранжевые линии) и ненужные (серые линии).Толстые линии — это усредненные отклонения Аллана и временные корреляции для всех штрих-кодов (красный) или джонков (черный). (e) Типичный двухмерный график корреляции для временной корреляции и отклонений Аллана для выбранных времен задержки, которые максимально разделяют штрих-коды и джойстики. Оранжевые пунктирные линии определяют пороговые значения, позволяющие отличить штрих-коды от ненужных. (f) Схема гибрида ДНК, используемого для оптимизации обнаружения штрих-кода в (g-k) (g) Ошибках FRET (SD), измеренных при различных интенсивностях возбуждающего лазера.Серая пунктирная линия указывает на асимптотический предел 0,04. (h) Время пребывания cy5-зонда при различных мощностях лазера. Серая пунктирная линия — ориентир для горизонтального сравнения. (i) Точность определения штрих-кода (SEM), рассчитанная для различного времени пребывания зонда. (j) Зависимость длины зонда от времени пребывания и времени связывания (среднее время, затраченное на новое событие связывания из предыдущего диссоциации зонда). (k) Зависимость концентрации зонда от кинетики связывания.

После фильтрации мусорных следов мы искали способ увеличить отношение сигнал / шум сигналов FRET штрих-кода.Наша микроскопия полного внутреннего отражения, оснащенная электронно-умножающим устройством с зарядовой связью (EMCCD), работала с максимальной чувствительностью обнаружения фотонов, и мы исследовали стандартное отклонение в определенных значениях эффективности FRET при увеличении мощности возбуждения. Для прямого сбора данных и анализа мы ковалентно прикрепили краситель cy3 к структуре гибридной ДНК и сохранили сайт связывания cy5-зонда в выступе оцДНК ( Fig. 2f и Supp. Fig. 1c ).Стандартное отклонение (SD) в нашем определении эффективности FRET (для каждого кадра 100 мс) уменьшалось с использованной интенсивностью лазера, приближаясь к асимптотическому пределу 0,04 на ~ 18,5 мкВт / мкм 2 ( Рис. 2g ). Это постоянное стандартное отклонение, вероятно, возникло из-за электронного дробового шума в EMCCD. Мы не наблюдали уменьшения времени пребывания единичных событий связывания, что указывает на то, что фотообесцвечивание не повлияло на наше определение кинетики диссоциации флуоресцентных зондов даже при максимальной использованной мощности ( Рис.2 ч. ).

Мы отметили, что точность определения штрих-кода FRET может быть дополнительно повышена за пределы асимптотического предела путем усреднения значений FRET, пока события привязки одного зонда продолжаются, потому что точность ограничивается стандартной ошибкой среднего (SEM), а не SD. . При изучении этого SEM значений FRET по отношению к разному времени усреднения мы обнаружили, что точность определения штрих-кода еще больше снизилась и достигла нижнего предела ΔE SEM ~ 0.01, когда время усреднения превышало 1 с ( Рис. 2i ). Затем мы изменили длину последовательности зонда, чтобы оптимизировать время выдержки единичных событий связывания ( Fig. 2j ). В то время как последовательность зонда из 8 нуклеотидов давала среднее время связывания порядка сотен миллисекунд, что, по-видимому, было слишком коротким для надежного определения FRET. Зонд длиной 10 нт, использованный в нашем исследовании, показал время пребывания ~ 20 с, что слишком долго, что увеличивает шансы связывания нескольких зондов в пределах оптического дифракционного предела.С другой стороны, cy5-зонд длиной 9 нт вернул время задержки ~ 2 с, что соответствует желаемому диапазону, который мы могли бы использовать для разработки системы обнаружения с более высокой мультиплексностью. Наконец, мы исследовали временной интервал между двумя последовательными событиями связывания как функцию концентрации зонда и обнаружили, что концентрации от 5 до 50 нМ давали латентность связывания от 5 до 20 с ( Fig. 2k, ). Эта задержка связывания немного больше, чем время задержки связывания, определенное выше, и, таким образом, разделяет отдельные события связывания с разумной вероятностью, предполагая, что диапазон концентраций от 5 до 50 нМ может использоваться с зондами длиной 9 нМ.

После оптимизации параметров для лучшего разрешения различения отдельных штрих-кодов FRET, мы разработали обширную гибридную структуру ДНК, которая может содержать до шести штрих-кодов FRET ( Рис. 3a, и Supp. Рис. 1d ). Стволовая часть работает как основа гибридной структуры, состоящей из трех оцДНК, называемых STEM 1, STEM 2 и биотинилированный STEM, которые гибридизуются друг с другом. В частности, STEM 1 и STEM 2 несли ортогональные последовательности гибридизации для принятия каждой из трех различных последовательностей штрих-кода FRET.

Рисунок 3. Одномолекулярный анализ штрих-кода FRET и идентификация отдельных компонентов из искусственных комплексов ДНК.

(а) Схема гибридных комплексов ДНК с шестью штрих-кодами FRET. (b) Изображение различных гибридных структур ДНК с различными комбинациями штрих-кода FRET. (c) Пример флуоресценции одной молекулы и временные кривые FRET, полученные из комплекса гибридной ДНК, состоящего из штрих-кода [F], штрих-кодов [A, C, E] и штрих-кодов [A, B, C, D, E, F]. На верхних панелях показана сумма интенсивностей донора и акцепторов, которые показаны отдельно на средних панелях.Связывающие события выделены темным цветом. На нижних панелях показаны рассчитанные значения КПД FRET. (d) Распределение эффективности FRET пиков, собранных из одного поля зрения. Сверху комплексы ДНК, состоящие из [F], [A, B], [D, F], [B, D], [A, C, E] и [A, B, C, D, E, F]. Сплошные линии соответствуют гауссовскому подходу для каждой подгруппы. Пунктирные линии обозначают положение каждой подгруппы населения.

Из 2 6 возможных комбинаций шести штрих-кодов мы попытались собрать шесть структур в качестве прецедентов ( Рис.3b ). После иммобилизации собранных структур на поверхности мы добавили cy3- и cy5-зонды, чтобы инициировать выборку эффективности FRET. Что касается кинетики связывания, определенной выше, мы выбрали последовательности длиной 9 нМ и концентрации 10 и 100 нМ для cy3 и cy5-зондов, соответственно. В этих условиях реакции практически все последовательности штрих-кода были полностью заняты cy5-зондами, в то время как cy3-зонды отбирали индивидуальную последовательность штрих-кода FRET порядка нескольких секунд.

Когда мы собрали значения FRET, полученные с помощью зондов cy3 для одиночных гибридных структур, гистограмма FRET отразила наличие всех присутствующих штрих-кодов FRET ( Рис.3c и Supp. Рис.4 ). Например, гистограмма FRET, полученная из единственной гибридной структуры со штрих-кодом F — с наибольшей спейсерной последовательностью 40 нуклеотидов, — показала низкую популяцию FRET при E ~ 0,2 рядом с пиком только для доноров при E ~ 0,1 ( Рис. 3в , первый ряд). Этот паттерн FRET был хорошо воспроизведен, когда мы взяли образцы 225 гибридных структур с тем же составом штрих-кода ( рис. 3d, , первая строка). В частности, мы отметили, что пик FRET, представляющий штрих-код F, имел узкую ширину 0.017, приближаясь к нижнему пределу ΔE SEM ~ 0,01, который мы обнаружили ранее. Для другой структуры с тремя штрих-кодами A, C и E мы наблюдали три четко выраженных популяции с высоким FRET при E ~ 0,37, 0,64 и 0,86 ( рис. 3d, , 5 -й ряд ). По сравнению с нашим предыдущим обнаружением трех штрих-кодов на Рисунке 1J, мы заметили, что улучшенные методы визуализации и усреднения, представленные на Рисунке 2, позволили добиться четкого разрешения трех штрих-кодов в виртуальном пространстве FRET. Наконец, мы сформировали гибридную структуру, включающую все шесть штрих-кодов FRET, и смогли различить все шесть пиков на гистограммах FRET, построенных из 343 структур ( рис.3д , 6 -й ряд ). Это примечательно, потому что мы не использовали замену буфера для замены зонда, предполагая, что пространство сигнала действительно было расширено до шести каналов при использовании двух физических каналов флуоресценции.

В этом отчете мы продемонстрировали метод штрих-кода ДНК, который обеспечивает мультиплексное обнаружение путем создания виртуальных каналов FRET. В качестве демонстрации концепции мы разработали гибридную структуру ДНК, которая содержит 6 штрих-кодов FRET размером ~ 10 нм.Мы значительно увеличили количество штрих-кодов FRET, которые можно разрешить за одно измерение, за счет оптимизации обработки сигналов и биохимических условий для отбора проб. Поскольку FRET возникает только тогда, когда донорный и акцепторный красители одновременно связываются с мишенью, наш штрих-код на основе FRET гораздо более устойчив к ложноположительному обнаружению и перекрестным помехам между физическими каналами флуоресценции, чем типичное обнаружение многоцветной флуоресценции. Мы предполагаем, что при добавлении еще одного спектрального канала, который создает два ортогональных пространства FRET, емкость мультиплексирования будет дополнительно увеличена до 6 2 = 36 каналов.Отметим, что наши измерения мультиплексированного штрих-кода FRET могут быть интегрированы с другим недавно разработанным методом FRET с высоким разрешением 28 , который позволяет точно определять FRET за пределами классического предела шума измерения из нескольких пар FRET. Хотя ранее был продемонстрирован мультиплексный анализ с использованием методов штрих-кодирования ДНК и ДНК-PAINT, эти методы основаны на введении различных наборов флуоресцентных зондов посредством замены микрофлюидного буфера. Наш метод FRET-штрих-кода расширяет пространство сигнала для данного набора датчиков, не требуя серьезных изменений в инструментах.Таким образом, мы ожидаем, что наш метод может быть напрямую интегрирован с уже существующими методами штрих-кода ДНК и PAINT 18, 19, 24 , обеспечивая путь к высоко мультиплексной визуализации биологической информации с увеличенной пропускной способностью.

Материалы и методы

ДНК

Синтезированные на заказ олигонуклеотиды ДНК без химических модификаций были приобретены у Macrogen. Олиго ДНК с модификациями аминогруппы, Cy3, Cy5 или биотина были приобретены у IDTDNA. Последовательности штрих-кода и гибридов были адаптированы из литературы 18 и модифицированы, чтобы избежать образования стабильной вторичной структуры.Для создания ДНК-гибридов, используемых в Fig. 1 , олигонуклеотиды смешивают вместе с соотношением 1: 2: 4: 8 для биотин-ДНК: STEM 1: STEM 2: FRET-штрих-коды. Смесь инкубировали в течение 24 часов при комнатной температуре и использовали без дополнительной очистки.

Одномолекулярная установка FRET

Микроскоп полного внутреннего отражения (TIR) ​​был специально построен на базе коммерческого инвертированного микроскопа (IX71, Olympus), оснащенного линзой объектива с большим увеличением (60X, NA1.2, погружение в воду, Olympus ) и emCCD (Ixon DU-897, Andor) ( Supp.Рис. 2а ) 22, 23 . Иммобилизованные образцы на кварцевом предметном стекле освещались лазером с длиной волны 532 нм, и сигнал флуоресценции был спектрально разделен на флуоресцентные каналы Cy3 и Cy5 с использованием двойного обзора (DV-2, Photometrics) перед отображением на emCCD для записи в реальном времени.

Анализ данных

Автоматический анализ флуоресцентного изображения был выполнен с помощью самодельного процессора изображений и анализатора временного графика флуоресценции, написанного в Matlab (MathWorks). Коды анализа находятся в свободном доступе на Github (https: // github.com / kahutia / transient_FRET_analyzer / Release / tag / v1.3 и https://github.com/kahutia/SingleMoleculeImageAnalyzer/releases/tag/V8.0). Во-первых, начальные 1000 кадров флуоресцентных изображений были использованы для построения изображения стандартного отклонения интенсивности. Затем изображение стандартного отклонения было проанализировано с помощью алгоритма поиска пиков для поиска областей интереса. Кривые интенсивности во времени в каждой области интереса были извлечены путем взвешивания по Гауссу суммы 9 ближайших соседей для каждого кадра. Поскольку связывание флуоресцентных зондов дало бы отчетливую кинетическую сигнатуру, следы, которые показывают аномальное поведение во временной корреляции и отклонении Аллана, были расценены как ненужные и исключены для дальнейшего анализа.Суммы интенсивностей доноров и акцепторов для каждого временного графика затем были классифицированы на две группы (группы с высокой и низкой интенсивностью) с использованием кластеризации К-средних с 2 состояниями. Среднее значение групп низкой интенсивности было установлено на фоне локальной интенсивности. Затем группы с высокой интенсивностью были дополнительно классифицированы путем выбора групп, показывающих ожидаемые диапазоны интенсивности для одной пары донор-акцептор. Затем выбранную группу соответствующей интенсивности использовали для расчета эффективности FRET каждого события связывания.

Примечания

Авторы заявляют об отсутствии конкурирующей финансовой заинтересованности.

Благодарности

Мы благодарим Чангвона Кима за активные обсуждения, касающиеся получения изображений FRET одиночных молекул. Это исследование было поддержано Программой развития биологических и медицинских технологий Национального исследовательского фонда (NRF), финансируемой Программой развития биологических и медицинских технологий (NRF-2018M3A9E2023523). Кроме того, это исследование было поддержано грантом Национального исследовательского фонда Кореи, финансируемым правительством Кореи (MSIT) (NRF-2020R1A5A1018081).

Сокращения

FRET
флуоресцентный резонансный перенос энергии
ДНК
Дезоксирибонуклеиновые кислоты
TIRF
микроскопия, флуоресцентная микроскопия полного внутреннего отражения.

Универсальный, масштабируемый и быстрый анализ на основе TR-FRET для обнаружения антигена SARS-CoV-2

ВВЕДЕНИЕ

Продолжающаяся пандемия коронавирусного заболевания 2019 (COVID-19) к декабрю 2020 года охватила почти полтора миллионов жизней во всем мире, с более чем 60 миллионами подтвержденных инфекций.Для лечения болезни ключевое значение имеют точные диагностические инструменты. Обнаружение возбудителя, тяжелого острого респираторного синдрома, коронавируса 2 (SARS-CoV-2) или его частей, является краеугольным камнем диагностики, поскольку проявления болезни часто неотличимы от других респираторных инфекций. Основой диагностики COVID-19 является тестирование RT-PCR, которое обычно проводится с помощью мазка из носоглотки (NPS), при этом также используются мазки из ротоглотки или средней носовой раковины, а также образцы слюны. В качестве альтернативы все чаще используются менее трудоемкие тесты на обнаружение антигенов.Тесты на антигены, как правило, специфичны, но аналитически менее чувствительны, чем ОТ-ПЦР. ОТ-ПЦР может обнаруживать вирусную нуклеиновую кислоту даже после того, как инфекционный вирус исчез, при этом индивидуум в это время вряд ли представляет риск передачи 1-3 . Имеющиеся данные свидетельствуют о том, что тестирование на антиген может лучше коррелировать с восстановлением инфекционного вируса, чем бинарная ОТ-ПЦР 4 . Частое тестирование на антигены было предложено в качестве альтернативного подхода к снижению передачи SARS-CoV-2 в сообществе 5 .

SARS-CoV-2 представляет собой оболочечный (+) ssRNA вирус рода Betacoronavirus семейства Coronaviridae из отряда Nidovirales . Он содержит четыре структурных белка: нуклеопротеин (NP) образует рибонуклеопротеидный комплекс с несегментированным вирусным геномом размером 30 т.п.н. Белки оболочки (E) и мембраны (M) встроены в оболочку, как и белок-шип (SP), выступающий из поверхности вириона и образующий большие выступы на поверхности, называемые короной.SP подвергается процессингу с образованием S1, который содержит рецептор-связывающий домен (RBD), первоначально прикрепляющий вирус к ангиотензин-превращающему ферменту-2 (ACE-2) на мембране клетки-хозяина, и S2, который опосредует слияние вирус-клетка. В ответ на пандемию доступны десятки коммерческих тестов на антиген SARS-CoV-2, преимущественно латерального потока или иммуноферментного типа. Наиболее целевой НП в качестве аналита 6 . Из семи тестов на антигены, получивших к декабрю 2020 года разрешение на экстренное использование (EUA) от США, США.S. Управление по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA), шесть мишеней N и одна S 7 .

В течение последних нескольких лет мы активно использовали резонансный перенос энергии Фёрстера с временным разрешением (TR-FRET) в качестве основы для быстрого гомогенного иммуноанализа «смешай и считывай» для обнаружения антител. 8-14 . FRET возникает, когда донор и акцепторный флуорофор находятся в непосредственной близости, в результате чего возбужденный донор передает энергию акцептору, который затем излучает фотон с определенной длиной волны. Чем ближе донор и акцептор, тем чаще происходит передача энергии, при этом эффективность 50% обычно достигается на расстоянии от 15 до 60 Å.TR-FRET с активированным донором хелатного лантанида позволяет проводить измерения на автофлуоресцентных биологических образцах.

Здесь мы описываем быстрый метод на основе TR-FRET для обнаружения SARS-CoV-2 NP и SP. В анализе поликлональные кроличьи антитела против NP и против RBD, каждое из которых мечено донорным или акцепторным флуорофором, объединяют в эквимолярном соотношении и смешивают с клиническим образцом. Антиген, если он присутствует, связывает меченые антитела и сближает флуорофоры.Это приводит к появлению сигнала TR-FRET при возбуждении, указывающего на присутствие антигена. Сначала мы демонстрируем пределы обнаружения рекомбинантных NP и SP, а также SARS-CoV-2, выращенного на культуре клеток. Затем мы оцениваем эффективность анализа среди 48 положительных при ОТ-ПЦР и 96 отрицательных клинических образцов НПВ и сравниваем результаты обнаружения антигена с результатами ОТ-ПЦР и культивирования вирусов.

МАТЕРИАЛЫ И МЕТОДЫ

Образцы пациентов и контрольные результаты

Оценка TR-FRET-анализа SARS-CoV-2 проводилась с использованием образцов мазков из носоглотки (NPS), собранных в физиологическом растворе.Образцы были взяты у пациентов с клиническим подозрением на COVID-19, и первоначально они были отправлены в Диагностический центр HUS, HUSLAB для тестирования SARS-CoV-2 RT-PCR. Затем образцы хранили при -20 ° C.

ОТ-ПЦР SARS-CoV-2 был основан на лабораторном тесте (LDT). Детали и выполнение теста в нашей лаборатории были описаны ранее 15 . В этом методе (на основе N-гена, модифицированного из Corman et al. 16 ) образцы были инактивированы путем объединения 250 мкл буфера для лизиса / связывания MagNA Pure (Roche Diagnostics GmbH, Мангейм, Германия) и 250 мкл буфера для лизиса / связывания. образец.Экстракцию нуклеиновой кислоты проводили из 450 мкл лизата образца с помощью набора MagNA Pure Viral NA SV 2.0 (Roche Diagnostics GmbH, Мангейм, Германия). ОТ-ПЦР выполняли с использованием набора SuperScript III Platinum One-Step qRT-PCR Kit с 600 нМ прямого праймера CACATTGGCACCCGCAATC, 800 нМ обратного праймера GAGGAACGAGAAGAGGCTTG и 200 нМ зонда FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ.

Положительная панель ОТ-ПЦР SARS-CoV-2 включала 48 образцов со значениями порога цикла (Ct), находящимися в линейном диапазоне от 11.42 и 29,98 в LDT. Панель с отрицательными результатами ОТ-ПЦР SARS-CoV-2 включала 96 образцов, отрицательных по результатам LDT. Данные пациентов были собраны, а образцы обработаны в соответствии с разрешением на исследования, утвержденным местным наблюдательным советом, разрешение HUS / 32/2018 (Университетская больница Хельсинки, Финляндия).

Клеточные линии, выделение и размножение вируса

Клетки Vero E6 трансдуцировали лентивирусным вектором, экспрессирующим трансмембранную сериновую протеазу 2 человека, TMPRSS2, кДНК варианта транскрипта 2 (NM_005656.4) и в качестве селективного маркера бластицидин.В частности, 1 мл отфильтрованного 0,22 мкм (Millipore) инфекционного супернатанта клеток HEK293T, трансфицированных на 10-см планшете за 48 часов до этого, с использованием 30 мкг полиэтиленимина с 5 мкг pLenti6.3 / V5-DEST TMPRSS2 (получено из Biomedicum Functional Genomics Unit, University из Хельсинки) и 5 ​​мкг p8.9NDSB 17 плюс 2-5 мкг pMD2.G (подарок от Дидье Троно, плазмида Addgene № 12259; https://n2t.net/addgene:12259; RRID: Addgene_12259) добавляли к клеткам Vero E6, засеянным на 6-луночные планшеты. После 2 дней отбора с 15 мкг / мл Blasticidin S HCl (Invitrogen) клеткам давали возможность разрастаться до слияния и трижды пересевали.После подтверждения отрицательного результата на р24 получали клональную популяцию клеток Vero E6-TMPRSS2 путем ограничивающего разведения. Полученные клоны (N = 5) анализировали на экспрессию TMPRSS2 иммуноблоттингом с антителом V5 (Invitrogen). Клон, экспрессирующий наибольшее количество TMPRSS2, VE6-TMPRSS2-h20, был выбран для использования.

Выделение SARS-CoV-2 из клинических образцов (хранящихся при -20 ° C со дня сбора, не подвергшихся замораживанию-оттаиванию) было предпринято как на клетках Vero E6, так и на клетках VE6-TMPRSS2-h20.Обе клеточные линии культивировали в Minimal Essential Medium Eagle (MEM, Sigma) с добавлением 10% фетальной бычьей сыворотки (FBS, Gibco), 100 МЕ пенициллина и 100 мкг / мл стрептомицина (Sigma) и 2 мМ L-глутамина (Sigma). . Для выделения клетки выращивали на 12-луночных планшетах примерно до 90% конфлюэнтности, ростовую среду заменяли 400 мкл MEM-2% (как указано выше, но с 2% FBS) с последующим добавлением 50 мкл образца NPS. (в условиях уровня биобезопасности 3) и 1 ч инкубации при 37 ° C, 5% CO 2 .После двух промываний MEM-2% культуры хранили в 1 мл свежего MEM-2% в течение 4 дней при 37 ° C (5% CO 2 ), среду собирали и осветляли центрифугированием (3000 x rcf, 5 мин. ), и клетки фиксировали в течение 15 мин при комнатной температуре 3,7% формальдегидом в фосфатно-солевом буфере (PBS) с последующей промывкой PBS и УФ-инактивацией (5000 x100 мДж, УФ-сшивающий агент, CL-1000, Jena Analytik). Фиксированные клетки окрашивали кристаллическим фиолетовым, и степень цитопатического эффекта (CPE) оценивалась от 0 до 3 (от ненаблюдаемой до обширной гибели клеток).Для подтверждения инфекции РНК экстрагировали (набор для экстракции вирусной РНК QIAgen QIAamp, следуя протоколу производителя) из 100 мкл супернатанта каждой клеточной культуры, и наличие или отсутствие SARS-CoV-2 анализировали с помощью ОТ-ПЦР, нацеленной на RdRp (РНК- зависимой РНК-полимеразы), как описано 16 .

Для экспериментов по обнаружению антигена TR-FRET мы произвели запас SARS-CoV-2 в клетках Vero E6 18 . Вкратце, 90-95% конфлюэнтных клеток Vero E6 инокулировали 500 мкл супернатанта, разведенного 1: 100, содержащего SARS-CoV-2 (пассаж 7, приблизительно 5 × 10 7 инфекционная доза культуры ткани 50, TCID50, на мл).Через 1 час адсорбции вируса среду заменяли MEM-2%, а через 2 дня при 37 ° C 5% CO2 супернатант собирали и осветляли центрифугированием (3000 x rcf, 5 минут) и хранили в аликвотах при −80 ° С. УФ-инактивацию супернатантов культур проводили, как описано выше.

Коронавирус человека 229E (hCoV-229E, любезно предоставлен доктором Сиско Тауриайнен, Университет Турку, Турку, Финляндия) и NL63 (hCoV-NL63, любезно предоставлен Лией ван дер Хук, Академический медицинский центр, Амстердам, Нидерланды). в качестве контроля для оценки перекрестной реактивности анализа.Исходный материал hCoV-229E получали путем инокуляции клеток почек макака-резуса, LLC-MK2 (от ATCC), с 500 мкл супернатанта культуры клеток, разведенного 1: 1000 (приблизительно 5 × 10 9 TCID50 / мл) в течение 1 часа при 37 ° С. C 5% CO2. После адсорбции вируса среду заменяли на MEM-2%, клетки выращивали в течение 5 дней (37 ° C, 5% CO2), супернатант собирали, центрифугировали (3000 x rcf, 5 мин) и хранили в аликвотах при — 80 ° С. Исходный материал hCoV-NL63 получали инокуляцией фибробластов легких человека (MRC-5, от ATCC) 500 мкл супернатантов культур клеток, разведенных 1: 100 (приблизительно 1 × 10 6 TCID50 / мл) в течение 1 ч при 37 ° C. 5% CO2.После адсорбции вируса среду заменяли на MEM-2%, клетки выращивали в течение 7 дней (до появления дефинитивного CPE), супернатанты собирали, центрифугировали (3000 x rcf, 5 мин) и хранили в аликвотах при -80 ° C. Супернатанты hCoV-229E и hCoV-NL63 были инактивированы для экспериментов путем смешивания в соотношении 1:10 в буфере RIPA (50 мМ Tris-HCl pH 8,0, 150 мМ NaCl, 1% NP-40, 0,1% SDS, 0,5% дезоксихолат натрия. и Roche cOmplete коктейль ингибиторов протеазы без ЭДТА).

Антигены и антитела

Производство и очистка антигенов SARS-CoV-2 NP и SP осуществлялась в соответствии с описанным протоколом 14,19,20 .RBD SP был получен в клетках Expi293F, как описано 19,20 . Кроличьи антисыворотки против RBD и NP были созданы в BioGenes GmbH (Берлин, Германия): начальная доза в 0 день 150 мкг, бустерная доза на 7 день 75 мкг, бустер на 14 день 75 мкг, бустер на 28 день 150 мкг и окончательное кровотечение на 42 день. Для аффинной очистки RBD и NP были связаны с CNBr-сефарозой 4B (Cytiva) в соответствии с протоколом производителя. Соответствующие антисыворотки пропускали через связанные сефарозы, упакованные в хроматографические колонки Poly-Prep (Bio-Rad), промывали 20 объемами колонки фосфатно-солевым буфером (PBS), элюировали (0.1 M глицин, 150 мМ NaCl, pH 2,5) с 2 M Tris, pH 9,0, концентрировали с использованием центробежного фильтра Amicon Ultra 15 мл 100 кДа-NMWL (Millipore / Merck) и диализовали против PBS с использованием кассет для диализа Slide-A-Lyzer ( Thermo Scientific).

Маркировка

Мы пометили аффинно очищенные антитела, 250 мкг / реакцию, донором (европий, Eu) и акцептором (Alexa Fluor 647, AF647), соответственно, с помощью набора для маркировки хелатных белков QuickAllAssay Eu (BN Products and Services Oy) и Alexa Fluor ™ 647 NHS Ester (Thermo Scientific) в соответствии с инструкциями производителя.Одноразовая колонка для обессоливания PD-10 со смолой Sephadex G-25 (Cytiva), служащая для удаления непрореагировавших флуорофоров, и центробежный фильтр Amicon Ultra 0,5 мл 50 кДа-NMWL (Millipore / Merck) для концентрирования меченых антител, которые затем хранились в виде аликвот. при −80 ° C до использования.

TR-FRET-анализы

Во-первых, мы настроили TR-FRET-анализы для SARS-CoV-2 SP и NP антигенов, используя соответствующие очищенные белки, а также соответствующие Eu- и AF-меченные анти-RBD и антигены. -NP антитела.Принцип анализа и рабочий процесс изображены на фиг. 1. Вкратце, смеси антител с эквимолярными концентрациями меченных Eu и AF концентраций антител против RBD и антител против NP готовили в буфере RIPA. Для настройки анализа пул из четырех образцов НПВ, отрицательных по SARS-CoV-2, был разделен на аликвоты и дополнен белками NP или SP в различных концентрациях. 10 мкл смеси антител вносили пипеткой в ​​384-луночный микропланшет (ProxiPlate 384 Plus F, Black 384-мелколуночный микропланшет, PerkinElmer, США), а затем 10 мкл образца с добавленным антигеном.Сигнал TR-FRET измеряли непосредственно после этого и в моменты времени 7, 15, 22, 30, 45, 60 и 90 минут после первого измерения с помощью считывающего устройства для микропланшетов Hidex Sense (Hidex Oy, Финляндия). Возбуждение донора FRET осуществляли при 330 нм, и после задержки в 70 мкс сигналы донора и акцептора измеряли в течение 100 мкс при 616 и 665 нм, соответственно. Сигналы TR-FRET выражали в виде отношений HTRF, рассчитанных следующим образом: отношение HTRF = излучение при 616 нм / излучение при 665 нм x 10000. После этого отношения HTRF, измеренные для образцов с добавленным антигеном, сравнивали с значениями, измеренными для образцов, не содержащих антиген. образец с добавками в том же цикле, чтобы рассчитать кратное увеличение отношения HTRF.Концентрации антител в планшете от 5 до 500 нМ (половина Eu- и половина AF-меченные) подвергали перекрестному титрованию с концентрациями антигена в планшете в диапазоне от 5 до 500 нМ.

Рис. 1.

Рабочий процесс и принцип анализа TR-FRET. Слева показаны компоненты реакции. В центре находится лунка, содержащая меченные донором и акцептором антитела в молярном соотношении 1: 1 в реакционном буфере, в нашей установке общая концентрация антител в этот момент составляет 24 нМ, а объем — 10 мкл. Стрелки указывают на добавление материала образца в нашей установке либо 10 мкл очищенного рекомбинантного белка, либо 10 мкл образца NPS.В правом верхнем углу схематично показаны комплексы антиген-антитело, образованные после добавления образца, содержащего антиген, реакционный объем на этом этапе в нашей установке составляет 10 мкл. Правая нижняя сторона схематически демонстрирует, что меченые антитела не образуют активных комплексов TR-FRET в отсутствие антигена.

Диапазоны концентраций антигена, определяемые с помощью TR-FRET (при концентрациях меченных Eu и AF анти-NP / -RBD, составляющих 6 + 6 нМ), затем оценивали, выполняя анализ, как описано выше, с использованием концентраций N и S на планшете От 5 фМ до 5 нМ.

Для оценки эффективности анализа с образцами, содержащими вирионы, использовали супернатанты клеточных культур, содержащие примерно 10 7 TCID50 / мл SARS-CoV-2. Для начальных экспериментов (проведенных в лаборатории BSL-3) использовали супернатант культуры инфекционных клеток (неразбавленный, 1:10, 1:25, 1:50 и 1: 100, разведенный в RIPA). После проверки того, что УФ-инактивированный вирус дает аналогичные результаты, в матрицу отрицательного NPS образца добавляли УФ-инактивированный вирус, содержащий супернатант клеточной культуры, с получением серии разведений от 1:10 до 1: 20480.Образцы тестировали в анализах TR-FRET, проводимых, как указано выше, при концентрациях меченных Eu и AF анти-NP / -RBD 6 + 6 нМ.

Анализ образца NPS выполняли путем смешивания 10 мкл образца с 10 мкл смесей антител (концентрации меченных Eu и AF анти-NP / -RBD составляли 6 + 6 нМ). Анализы TR-FRET с образцами SARS-CoV-2, положительными по НПВ, проводились в лаборатории BSL-3, а отрицательные образцы ОТ-ПЦР — в лаборатории BSL-2. Сигналы, продуцируемые hCoV-229E и hCoV-NL63, оценивали путем смешивания 10 мкл (неразбавленного, 1:10, 1:25, 1:50 и 1: 100, разведенного в RIPA) супернатанта клеточной культуры с 10 мкл смеси антител (при концентрациях меченных Eu и AF анти-NP / -RBD 6 + 6 нМ).

РЕЗУЛЬТАТЫ

Подтверждение концепции для анализа гомогенного обнаружения антигенов

Мы предположили, что гомогенное, то есть в растворе, обнаружение антигенов может быть достигнуто с использованием поликлональных антител, отдельно меченных флуорофорами, образующими пару FRET. Чтобы проверить гипотезу и принцип анализа, представленные на рис. 1, мы создали антисыворотку против SARS-CoV-2 NP и RBD SP, титры> 204 800 на основе NP и SP ELISA соответственно. После аффинной очистки антитела метили хелатным европием (Eu, донор) и AlexaFluor 647 (AF647, акцептор).В первых экспериментах мы проверили принцип анализа, смешивая рекомбинантные NP и SP с 1 мкМ (500 нМ меченых Eu + 500 нМ AF647) смесей антител против NP и RBD в присутствии увеличивающегося количества бычьего сывороточного альбумина (BSA ) концентрации. Добавление BSA увеличивало отношение сигнал / шум, побуждая нас оценивать характеристики анализа с дальнейшим использованием надосадочных жидкостей клеточных культур, содержащих инфекционный SARS-CoV-2, и различных составов буферов. Анализ с концентрацией антител 1 мкМ дал приличное отношение сигнал / шум в буфере RIPA (анализ радиоиммунопреципитации), содержащем детергент (рис.S1). Буфер RIPA (полный рецепт см. В материалах и методах), использованный здесь, содержал 1% NP-40 и 0,1% SDS, которые, как было показано, эффективно инактивируют окруженный SARS-CoV-2 21,22 , поэтому мы должны использовать RIPA для последующих анализов.

Оптимизация анализа с использованием рекомбинантных антигенов и SARS-CoV-2

Для оптимизации результатов анализа мы смешали меченые антитела в эквимолярном соотношении с известными количествами рекомбинантных NP и SP и записали полученные сигналы TR-FRET (как HTRF, однородная флуоресценция с временным разрешением, значения) как функция времени.Результаты показали, что анализы дают самые высокие значения HTRF, когда концентрация меченых антител равна концентрациям очищенных соответствующих антигенов (рис. S2). Более высокие концентрации антител сокращали время, необходимое для достижения пика сигнала (кратное увеличение значения HTRF, HTRF , образец / HTRF буфер ): при концентрации антитела 5 нМ (2,5 нМ Eu- + 2,5 нМ AF647-меченного) для достижения пика сигнала как для NP, так и для SP потребовалось ~ 60 мин, тогда как при концентрации антитела 500 нМ пик сигнала NP наступал через 7 минут, а пик сигнала SP достигался через ~ 30 минут.Мы также проверили характеристики анализа с Eu- и AF-меченными антителами, смешанными в неравных пропорциях 1: 2 и 2: 1, но это не увеличило отношение сигнала к фону (Таблица S1).

Затем мы оценили эффективность анализа при общих концентрациях антител 50, 25, 12 и 6 нМ с использованием супернатантов клеточных культур, содержащих SARS-CoV-2, в различных разведениях. Мы включили УФ-инактивированный супернатант клеточной культуры, чтобы выяснить, повлияет ли УФ-инактивация на анализ. Результаты совпали с результатами, полученными с использованием рекомбинантных антигенов, и показали зависимость кинетики сигнала TR-FRET от концентрации антигена (рис.S3). Результаты также показали, что общая концентрация антител 12 нМ позволяет измерять антигены в широком диапазоне концентраций вирусов, и что инфекционный и УФ-инактивированный SARS-CoV-2 дает аналогичные результаты.

Пределы обнаружения

Чтобы оценить пределы обнаружения (LOD) для анализов при общей концентрации антител 12 нМ, мы добавили в пул образцов NPS либо очищенные антигены, либо инактивированный SARS-CoV-2 в различных разведениях. Для очищенных антигенов самые низкие концентрации, дающие легко обнаруживаемые сигналы, были равны 0.05 нМ для NP и 0,5 нМ для SP (рис. S4, a-b). С УФ-инактивированным SARS-CoV-2 разведения супернатанта до 1: 5120 и 1: 160 давали надежно измеряемые сигналы с антителами против NP и против RBD, соответственно (рис. S4, c-d). При объеме образца 10 мкл предел обнаружения анализа для рекомбинантных NP составлял ~ 25 пг (с использованием молекулярной массы 50 кДа) и 875 пг для SP (с использованием молекулярной массы 175 кДа). Соответственно, анализ NP может выявить примерно 15, а анализ RBD — примерно 420 бляшкообразующих единиц (преобразованных с использованием 0.7 x TCID50 / мл = БОЕ / мл) на реакцию.

Обнаружение антигенов SARS-CoV-2 в образцах НПВ

После настройки условий анализа с использованием рекомбинантных белков и вируса, выращенного на клеточной культуре, мы протестировали тесты на обнаружение вирусного антигена в НПВ, положительных при ОТ-ПЦР SARS-CoV-2. образцы. У нас было 48 образцов НПВ со значениями порога цикла ОТ-ПЦР (Ct) в линейном диапазоне от ~ 12 до 30 (рис. S5), и использовали общие концентрации антител 50, 25, 12 и 6 нМ. Мы наблюдали, что образцы со значениями Ct ≤25 давали сигнал в анализе NP (рис.S6). При использовании оптимизированных условий с общим количеством меченых антител 12 нМ чувствительность анализа NP TR-FRET по сравнению с RT-PCR составила 77,1% (37/48). Анализ SP показал большее разнообразие; большинство образцов со значениями Ct ≤15 дали положительный результат (рис. S6). Мы также выполнили иммуноблоттинг для обнаружения NP и SP в образцах NPS, охватывающих диапазон значений Ct от 12,8 до 26,2, и смогли обнаружить SP и NP в образцах со значением Ct <22 (рис. S7).

Связь между обнаружением инфекционного вируса и антигена

Чтобы определить, в какой степени анализы антигена соответствуют количеству инфекционного вируса в образце, мы подвергли 48 SARS-CoV-2 RT-PCR-положительных НПВ вирусам.Сообщалось, что трансмембранная сериновая протеаза 2 (TMPRSS2) действует при праймировании пика SARS-CoV-2 для входа 23 , и поэтому мы выбрали использование как дикого типа, так и клональной популяции экспрессирующих TMPRSS2 (VE6-TMPRSS2-h20). ) Vero E6 клетки (рис. S8). Как показали цитопатические эффекты, а также ОТ-ПЦР из супернатантов клеточных культур, SARS-CoV-2 был выделен из 35/48 и 38/48 образцов NPS с клетками Vero E6 и VE6-TMPRSS2-h20 соответственно. Интересно, что супернатанты клеточных культур от клеток VE6-TMPRSS2-h20 дали положительный результат на 3-5 циклов раньше, чем супернатанты от клеток Vero E6, что указывает на эффективность продукции вируса в ~ 10-40 раз (рис.S9). В целом инфекционный SARS-CoV-2 был выделен из всех образцов, показывающих значения Ct ≤24,5. Затем мы сравнили анализ антигена с выделением вируса из соответствующих образцов и наблюдали, что все образцы со значениями Ct ≤24,5 оказались положительными в анализе NP (рис. 2а). Из образцов со значениями Ct> 24,5 все дали отрицательный результат в анализе TR-FRET NP, а SARS-CoV-2 был восстановлен только из одного (Ct 24,87). При использовании оптимизированных условий с общим количеством меченых антител 12 нМ чувствительность анализа NP по сравнению с выделением вируса составила 97.4% (37/38). Производительность теста SP была хуже; только 8/38 образцов с восстанавливаемым SARS-CoV-2 дали положительный результат (рис. 2b).

Рисунок 2.

Сравнение обнаружения антигена на основе TR-FRET и количества вируса, проанализированного с помощью ОТ-ПЦР SARS-CoV-2 и выделения вируса из образцов НПВ. Общая концентрация антител в анализах составляет 12 нМ (6 нМ Eu- и 6 нМ антитела, меченного AF647). а) Результаты анализа против NP. б) Результаты анализа анти-RBD. Ось Y (логарифмическая шкала) показывает кратное увеличение отношения HTRF (HTRF , образец / HTRF буфер ), измеренное непосредственно после пипетирования образцов на планшете.По оси абсцисс показано значение Ct, измеренное в диагностической ОТ-ПЦР SARS-CoV-2. Горизонтальная черная линия представляет собой границу положительного результата теста на антиген, соответствующую среднему значению плюс четыре стандартных отклонения сигналов, индуцированных отрицательными образцами ОТ-ПЦР SARS-CoV-2. Вертикальная черная линия разделяет образцы НПВ с положительной (n = 48) и отрицательной (n = 96) ОТ-ПЦР SARS-CoV-2. Цвет на графиках указывает на наличие (красный) или отсутствие (синий) цитопатического эффекта (ЦПЭ) после инокуляции клеток VE6-TMPRSS2-h20 с 50 мкл образца NPS, черный = не культивированный.TR-FRET = резонансный перенос энергии Фёрстера с временным разрешением, NP = нуклеопротеин, RBD = рецептор-связывающий домен, HTRF = гомогенная флуоресценция с временным разрешением.

Ложноположительная реакция и перекрестная реактивность

После обнаружения общей концентрации антител 12 нМ, идеальной для проведения анализа, нам было интересно узнать частоту ложноположительных результатов. С этой целью мы протестировали в тестах на антиген TR-FRET 96 SARS-CoV-2 ОТ-ПЦР-отрицательных образцов НПВ. Параллельно мы изучали потенциальную перекрестную реактивность выращенных на культуре клеток сезонных коронавирусов простуды hCoV-229E и hCoV-NL63 в анализах TR-FRET.Среди образцов NPS с отрицательными результатами ОТ-ПЦР SARS-CoV-2 только один дал положительный сигнал HTRF. Мы повторно проанализировали этот образец с помощью другого анализа RT-PCR (Xpert Xpress SARS-CoV-2, Cepheid), подтвердив отрицательный результат. Чтобы оценить антиген-специфичность сигнала, мы также проанализировали этот образец, используя несовпадающие комбинации меченых антител против NP и против RBD. Все комбинации дали положительный результат, что свидетельствует о том, что меченые антитела связывают не только антигены, но и нечто иное.При использовании оптимизированных условий с общим количеством меченых антител 12 нМ специфичность анализов NP и SP TR-FRET по сравнению с RT-PCR составила 99,0% (95/96), а по сравнению с выделением вируса — 100% (10/10). Затем мы установили в качестве пороговых значений для анализов TR-FRET среднее значение плюс четыре стандартных отклонения сигналов от SARS-CoV-2 RT-PCR отрицательных образцов NPS (за исключением одного выброса). При использовании этих пороговых значений ни hCoV-229E, ни hCoV-NL63 не давали значимого сигнала TR-FRET в анализе NP или SP (рис.3). Результаты со значениями отсечения, выбранными с использованием отрицательных образцов NPS, совпадали с результатами произвольных отсечений, использованных ранее, и суммированы на рисунке 2.

Рисунок 3. Анализ перекрестной реактивности

SARS-CoV-2 TR-FRET антигена, оцененный супернатанты культур клеток сезонных коронавирусов человека hCoV-229E и -NL63. a) Результаты анализа анти-NP с супернатантами культур клеток HCoV-229E и -NL63 при различных разведениях. б) Результаты анализа анти-NP с супернатантами культур клеток HCoV-229E и -NL63 при различных разведениях.Ось Y (логарифмическая шкала) показывает кратное увеличение отношения HTRF (образец HTRF / буфер HTRF ). Горизонтальные линии указывают соответствующие пороговые значения анализа TR-FRET. УФ-инактивированный SARS-CoV-2, содержащий супернатант клеточной культуры, включен в качестве положительного контроля.

ОБСУЖДЕНИЕ

Эпидемия SARS-CoV-2, начавшаяся в Китае в конце 2019 года, быстро переросла в пандемию весной 2020 года. После первоначального отставания в наращивании возможностей тестирования ОТ-ПЦР быстро стала золотым стандартом острой атипичной пневмонии. -CoV-2 диагностика.Хотя ОТ-ПЦР очень чувствительна для выявления людей с острой инфекцией, обратная сторона заключается в том, что пациенты, выздоравливающие от COVID-19, могут оставаться положительными на ОТ-ПЦР в течение длительного периода. С другой стороны, тестирование на антигены несколько менее чувствительно для выявления пациентов с острой инфекцией; тем не менее, похоже, что существует лучшая корреляция между присутствием антигена и инфекционного вируса в образцах NPS. В этой рукописи мы описываем разработанный в лаборатории тест для обнаружения антигена SARS-CoV-2 в образцах НПВ и сравниваем его эффективность с выделением вируса и ОТ-ПЦР.Анализ быстр и очень прост в использовании, кроме того, анализ довольно несложен в настройке при условии, что доступны специфические антитела против структурных белков вируса. Хотя мы используем поликлональные антитела в анализе, его, вероятно, можно было бы настроить с помощью моноклональных антител. Флуорофоры (хелатный Eu и AlexaFluor 647) легко доступны, и результаты можно прочитать на любом считывающем устройстве для микропланшетов, способном измерять флуоресценцию с временным разрешением. Примечательно, что мы настроили анализ в содержащем детергент буфере RIPA, который содержит 1% NP-40 и 0.1% SDS, оба из которых инактивируют SARS-CoV-2 21,22 . Таким образом, сбор образцов НПВ непосредственно в эту матрицу значительно повысил бы безопасность конечного пользователя.

Мы настроили анализ для обнаружения как NP, так и SP SARS-CoV-2, но наблюдали четкую разницу между LOD в двух анализах с NP, обнаруживаемым примерно в 35 раз более низкой концентрации. Вероятно, это объясняется тем, что мы использовали антитело, направленное против RBD, которое составляет лишь около одной шестой SP.Тот факт, что используемое антитело распознает только один домен, может сделать стерически невозможным для двух молекул антитела связывание одной молекулы SP, и поэтому мы предполагаем, что полученный сигнал исходит от тримеров SP, то есть шипов. NP более многочисленны как в вирионах, так и в инфицированных клетках (см. Рис. S7), что дополнительно способствовало более высокой чувствительности обнаружения NP в супернатантах клеточных культур и образцах NPS.

Анализ эффективности анализа антигена с использованием образцов NPS от 48 SARS-CoV-2 RT-PCR-положительных и 96 отрицательных лиц показал, что анализ NP правильно идентифицировал 37 положительных образцов и все отрицательные образцы, кроме одного.Все 37 истинно положительных результатов имели значение Ct <25 циклов диагностической ОТ-ПЦР. Как и в других исследованиях, мы наблюдали сильную связь между инфекционностью образца и положительным результатом теста на антиген; из 38 образцов, которые дали изолят 37, дали положительный результат в анализе NP. Мы использовали 50 мкл для выделения вируса, в то время как для анализа антигена требуется только 10 мкл, что может объяснить, почему один из образцов с инфекционным вирусом не был взят. Мы намеренно выбрали образцы NPS в широком диапазоне значений Ct в ОТ-ПЦР SARS-CoV-2, чтобы получить оценку предела обнаружения по сравнению с ОТ-ПЦР.Тот факт, что мы проанализировали образцы, которые не были собраны в свежем виде и были подвергнуты по крайней мере одному циклу замораживания-оттаивания, мог отрицательно повлиять на чувствительность анализа. В любом случае наш тест смог обнаружить 97,4% образцов NPS с инфекционным вирусом.

Поскольку анализы антигенов NP и SP дали положительный результат для одного отрицательного образца ОТ-ПЦР SARS-CoV-2, мы повторно проанализировали его с помощью другой ОТ-ПЦР с отрицательным результатом. Мы также попытались выделить вирус из образца, но безуспешно.Не исключено, что ложноположительный результат является результатом перекрестной реактивности на человеческий коронавирус, hCoV, инфекцию. Из hCoV только hCoV-NL63 и SARS-CoV используют тот же рецептор, что и SARS-CoV-2, то есть ангиотензинпревращающий фермент 2 (ACE2) 24,25 . Таким образом, было бы наиболее логично, что реактивность этого образца будет обусловлена ​​hCoV-NL63, поскольку анализы SP (на основе RBD) и NP дали положительный результат. Тем не менее, мы протестировали два анализа с использованием hCoV-229E и hCoV-NL63, выращенных в культуре клеток, но с отрицательными результатами.Похоже, что образец, дающий ложноположительную реакцию, содержал мешающее вещество, которое вызывало агрегацию иммуноглобулинов, поскольку также меченые антитела против различных антигенов давали сигнал TR-FRET. Использование антител с несовпадением может в будущем служить для различения истинных и ложноположительных результатов в анализе TR-FRET.

В заключение мы сообщаем о разработке быстрого теста на антиген SARS-CoV-2, основанного на одновременном связывании двух или более молекул антител, меченных флуорофором, с антигеном.Тест на антиген на основе TR-FRET выполняется быстро, и его результаты хорошо коррелируют с наличием инфекционного вируса в клинической пробе. Анализ легко настроить, если доступны подходящие антитела против SARS-CoV-2 NP и планшет-ридер, позволяющий измерять TR-FRET. По нашим оценкам, один считыватель планшетов и опытный техник могут вручную анализировать сотни образцов в час, в идеале с 30-минутным временем обработки от прибытия образца до получения результатов (подробности см. В дополнительной информации).Производительность анализа может быть значительно увеличена за счет автоматизации, и, как и в случае ОТ-ПЦР, сбор образцов будет основным ограничивающим фактором. Отбор проб NPS непосредственно в буфер, содержащий детергент, повышает безопасность анализа. Мы предполагаем, что анализ может широко применяться в полевых условиях, например больницах, домах престарелых, аэропортах и ​​вокзалах, а также в школах для выявления людей, которые могут распространить вирус.

Обнаружение клеток гибридомы по FRET

Анализ DiO-DiI FRET

L Ипофильные карбоцианиновые красители DiO и DiI десятилетиями используются в проточной цитометрии для маркировки.DiO возбуждается на 484 нм и излучает на 501 нм, в то время как DiI максимально возбуждается на 549 ​​нм, может возбуждаться на 488 нм и излучать на 565 нм. Таким образом, DiO и DiI могут собираться в каналах FITC и PE проточных цитометров. Феномен FRET можно использовать для определения эффективности продуцирования гибридомных клеток проточно-цитометрическим методом, поскольку пик излучения DiO (донор) перекрывается с пиком возбуждения DiI (акцептор), что позволяет возникать FRET.

Клетки, которые должны быть слиты, метят DiO (донор) или DiI (акцептор), и в присутствии PEG (полиэтиленгликоля) клетки сливаются, давая дважды положительную популяцию.Компенсация устанавливается с использованием двух популяций клеток, помеченных DiO или DiI, и немеченых клеток. Таким образом, можно определить средние значения флуоресценции для отдельных положительных популяций для DiO и DiI, а также фоновые значения для DiO и DiI. Эти значения необходимы для расчета FRET, см. Процедуру расчета для клеток с двойной меткой и гибридом.

FRET возникает, когда происходит передача энергии от донора к акцептору, что приводит к увеличению флуоресценции донора.Таким образом, если происходит FRET, средняя флуоресценция акцептора DiI будет выше, чем у одноцветного контроля DiI; в то время как средняя флуоресценция DiO будет уменьшаться ниже контрольного значения одного цвета DiO. Положительный контроль FRET (эффективность 25%) для обнаружения клеток гибридомы может быть получен путем двойного мечения тех же клеток с помощью DiO и DiI, это можно увидеть на рисунке.
Гибридомные клетки дают совершенно другой профиль флуоресценции DiO и DiI по сравнению с клетками с двойной меткой, но имеют повышенную эффективность FRET по сравнению с положительным контролем с двойной меткой на 37%, см. Рисунок.

Как измерить FRET

В моей предыдущей статье о FRET я рассказал вам о FRET — его механизме и приложениях. Здесь я расскажу, что нужно измерять при выполнении FRET.

Существует несколько подходов к количественной оценке FRET:

  1. Сенсибилизированное излучение — Этот двухканальный метод визуализации использует алгоритм, который корректирует перекрестные помехи возбуждения и излучения.
  2. Фотообесцвечивание акцептора — Этот метод, который иногда называют декухшингом донора, измеряет повышенную эмиссию донора, когда акцептор фотообесцвечивается.
  3. Флуоресцентная микроскопия для визуализации времени жизни FRET (FLIM FRET) — Этот метод обнаруживает изменения времени жизни флуоресценции донора.
  4. Донор флуорофора Спектральная визуализация — Этот метод включает возбуждение на одной или двух длинах волн и измерение спектральных профилей как донора, так и акцептора.
  5. Homo-FRET и поляризация Anisotropy Imaging — Этот метод использует идентичные донорные и акцепторные флуорофоры и определяет FRET путем измерения поляризации.

1. Сенсибилизированная эмиссия

Как я уже упоминал в своей первой статье о FRET, сенсибилизированное излучение, пожалуй, самый простой метод FRET. В этом методе возбуждается донорный флуорофор, и сигнал собирается с использованием фильтров излучения, выбранных как для флуоресценции донора, так и для флуоресценции акцептора.Флуоресценция акцептора увеличивается в присутствии донора, тогда как флуоресценция донора уменьшается в присутствии акцептора. Затем ратиометрическое изменение интенсивности флуоресценции можно использовать для измерения FRET.

Если бы не было перекрестных помех между двумя флуорофорами, этот метод был бы идеальным — однако перекрестные помехи между флуоресцентными белками все же существуют. Таким образом, при таком подходе сложно получить количественно точные данные FRET. Кроме того, вам по-прежнему необходимы соответствующие контрольные эксперименты, чтобы установить наличие или отсутствие FRET.Но, несмотря на эти ограничения, сенсибилизированные измерения эмиссии могут быть полезны для обнаружения быстрых динамических изменений и особенно полезны при исследовании флуоресцентных белковых биосенсоров, где динамический диапазон FRET велик, а стехиометрия донора и акцептора зафиксирована в соотношении 1: 1.

2. Акцепторное фотообесцвечивание

Фотообесцвечивание акцептора — это метод, основанный на том факте, что флуоресценция донора гасится во время FRET, когда часть энергии флуоресценции донора передается акцептору.Но фотообесцвечивание акцепторного флуорофора останавливает его флуоресценцию и, следовательно, использование части энергии донора, что приводит к увеличению флуоресценции донора. Это явление можно использовать для расчета эффективности FRET путем вычитания интенсивности донора в присутствии акцептора из его интенсивности после фотообесцвечивания акцептора и деления результата на интенсивность донора после обесцвечивания.

Акцепторное фотообесцвечивание — очень простой метод и, пожалуй, наиболее широко используемый метод FRET.Его главный недостаток в том, что его можно использовать только один раз на ячейку. Кроме того, это относительно медленный процесс. При разработке экспериментов по фотообесцвечиванию акцепторов важно помнить о том, что необходимо убедиться, что флуоресценция донора не затронута (это включает в себя тщательный выбор длины волны и интенсивности отбеливания) и что акцептор фотообесцвечивается примерно до 10% от своего начального значения.

3. FLIM FRET

Все флуоресцентные молекулы демонстрируют характер затухания в своей флуоресцентной эмиссии в наносекундном масштабе, и скорость этого распада чувствительна к параметрам окружающей среды.Визуализирующая микроскопия за время жизни флуоресценции (FLIM) — это метод, который вычисляет эту картину распада и с ее помощью дает информацию о состоянии белка и факторах в клеточной микроокружении. В FLIM FRET флуоресценция донора гасится взаимодействием FRET, и степень гашения может быть рассчитана путем измерения уменьшения времени затухания флуоресценции молекулы донора.

Существенным преимуществом метода измерений FLIM-FRET является его нечувствительность к артефактам прямого акцепторного возбуждения.Обратной стороной этого метода является то, что он требует высокоспециализированного и дорогого оборудования. Кроме того, как и Acceptor Photobleaching, FLIM-FRET работает относительно медленно, что ограничивает возможности его применения. Наконец, поскольку FLIM чувствителен к факторам локальной микросреды, при интерпретации FLIM-FRET нужно быть осторожным, чтобы исключить артефакты.

4. Спектральная визуализация

При построении спектральных изображений весь спектр излучения, содержащий как донорную, так и акцепторную флуоресценцию, регистрируется при возбуждении донора.Это своего рода спектроскопия для микроскопа, основанная на том принципе, что перекрывающиеся спектры можно разделить не только по их пикам излучения, но и по их различным общим формам.

Для этой техники также требуется специализированное оборудование, но стоимость не такая высокая, как у FLIM-FRET. Основным недостатком этого подхода является пониженное отношение сигнал / шум, связанное с получением полных спектров излучения обоих флуорофоров, в отличие от сбора двух каналов на пике излучения.

5. Гомо-FRET и визуализация поляризационной анизотропии

Как и обычный FRET, гомо-FRET включает в себя передачу энергии возбужденного состояния между флуорофорами, расположенными в пределах ~ 10 нм друг от друга, но с той разницей, что эти флуорофоры идентичны. В этом случае нет никаких изменений в сроке службы или спектре излучения. Тогда как мы можем понять это?

Когда случайно ориентированная популяция флуоресцентных молекул возбуждается линейно поляризованным светом, происходит преимущественное возбуждение только тех флуорофоров, дипольный вектор поглощения которых оказывается параллельным азимуту поляризации.Большая часть излучаемого света остается поляризованной после возбуждения, и этот свет можно наблюдать с помощью анализатора, ориентированного параллельно вектору поляризации возбуждающего света. Уровень сигнала после анализатора будет уменьшаться либо если флуорофор вращается в масштабе времени эксперимента, либо если он передает энергию возбуждения из-за FRET соседнему белку, имеющему другую ориентацию. Однако, поскольку для молекул такого размера передача энергии может происходить намного быстрее, чем вращение молекул, можно распознать деполяризацию из-за FRET.Таким образом, мы можем изобразить кластеризацию идентичных молекул в клетках. Этот метод хорошо подходит для приложений скрининга с высоким содержанием, поскольку данные могут быть получены быстро.

Какие флуорофоры использовать?

Спектры поглощения флуорофоров становятся шире по мере того, как мы переходим к более длинным длинам волн, что делает такие флуорофоры менее подходящими для этого FRET. И хотя были достигнуты значительные успехи в расширении полезной области для FRET в оранжевую, красную и дальнюю красную области спектра, оптимизированные версии CFP и YFP остаются самой полезной и самой популярной парой FRET.В любом случае идеальной пары FRET не существует. Точно так же не существует идеальной техники для измерения FRET. Пользователь должен решить, какую пару и какой метод использовать, в зависимости от типа рассматриваемого эксперимента и на основе доступной литературы.

Хотя проблема обширна, я могу дать вам несколько кратких сведений о том, как можно оптимизировать FRET в его наиболее распространенной форме, фотообесцвечивании акцепторов:

  • Выберите подходящие донорные и акцепторные флуорофоры.
  • Выберите подходящую схему маркировки.
  • При использовании антител оптимизируйте соотношения и условия мечения антител и убедитесь, что антитела не реагируют друг с другом.
  • Определите соответствующие положительные и отрицательные контроли.
  • Определите оптимальные условия фотообесцвечивания для акцептора.
  • Применяйте количественные сравнения только в экспериментах, проводимых одновременно.
  • Помните об артефактических причинах изменений флуоресценции донора (например,грамм. химическая конверсия).
  • Оптимизируйте размер выборки для статистического анализа.

Вам это помогло? Тогда поделитесь, пожалуйста, со своей сетью.

Пять вопросов Билли Гиббонсу из ZZ Top

В прошлом месяце мы сели с Билли Гиббонсом для продолжительной дискуссии о гитарах, истории музыки Техаса и многом другом. Вы найдете интервью и десятки эксклюзивных фотографий в новом журнале Fretboard Journal № 26, который выйдет летом 2012 года.А пока вот пять вопросов, которые не вошли в список, по всем, от Girl Fridays и Flying V до акустики.

Fretboard Journal: Когда вы впервые сформировали ZZ Top, на каких гитарах вы играли и почему?

Билли Гиббонс: Gibson Flying V 1957 года выпускал первую волну звуков ZZ. Этот V восполнил счет в поисках Гибсона середины 50-х с хамбакерскими звукоснимателями. Звукосниматели Gibson хамбакеры, конечно, считались движущей силой жестоких звуков, к которым все, казалось, стремились.

FJ: У вас огромная коллекция гитар. Как вы отслеживаете? Есть где-нибудь электронная таблица?

BG: Удача иметь праведную девушку Пятница — ключ к успеху. Так много движений между студийными свиданиями и гастрольными вызовами на сцену, доверчивая душа, которая отслеживает «забота и где» является истинным спасением. Она всегда рядом, чтобы помочь захватить и пойти!

FJ: Вы известны тем, что у вас есть корпуса большинства ваших гитар.Вы также играете на легких струнах (7-го калибра). Как вы наткнулись на эти открытия?

BG: Что ж, роскошь этих обтягивающих семерок — явная странность для многих, но идея использования тонкой струны была направлена ​​мне не кем иным, как Би Би Кингом, который случайно взял в руки Я воткнул топор в угол, привязанный какой-то жесткой, тяжелой проволокой, и спросил: «Почему ты так много работаешь?» Следуя этому интересному примеру, мы перешли к тонкой струне.

FJ: У вас есть современные строители, которые постоянно создают для вас гитары по индивидуальному заказу.Есть ли гитары, которые вы хотели (или хотели сделать), но не могли достать?

BG: Еще нет. Верна поговорка: «Одного слишком много, а сотни — мало!» Тем не менее, наш главный человек, мистер Джон Болин, который руководит работой в Bolin Guitars, обладает самым одаренным чутьем, когда дело доходит до создания гитар. Пофантазируйте, и это будет сделано.

FJ: Вы когда-нибудь играли на акустической гитаре?

BG: Акустика? Вне вопроса.Мне не повезло. Позвольте мне подключить эту штуку и показать вам, почему!

Подпишитесь на The Fretboard Journal сегодня, и мы позаботимся о том, чтобы вы получили этот выпуск.


Нравится? Другие истории на fretboardjournal.com, которые вам стоит посмотреть:

Динамическая настройка FRET в биосенсоре зеленого флуоресцентного белка

РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ

Кристаллическая структура Twitch-2B

Мы расшифровали структуру с разрешением 2.5 Å (таблица S1A). Асимметричный блок состоит из двух мономеров (рис. S1A). Они представляют идентичные конформации отдельных доменов [среднеквадратичные отклонения (RMSDs) ниже 0,2 Å] и несколько иную междоменную конформацию (RMSD 0,992 Å), но, по-видимому, не собираются как симметричный гомодимер. Их интерфейс (рис. S1B), покрывающий 630 Å 2 ( 11 ), на самом деле значительно меньше, чем интерфейс стабильного димера ( 12 ). Кроме того, данные малоуглового рентгеновского рассеяния (МУРР) показывают, что в растворе Twitch-2B является мономерным (рис.S2). Поэтому мы сфокусируем наше описание здесь на мономере A. Кристаллическая структура показывает расположение донора и акцептора относительно минимального кальций-связывающего домена TnC, а также структуру оптимизированных линкеров (рис. 1). Структура кальций-связывающего домена очень похожа на C-концевой глобулярный домен куриного TnC (RMSD 0,84 Å) ( 13 ), на структуру ЯМР, решенную ранее ( 8 ), и на структуру кальмодулина. (RMSD 1,08 Å) ( 14 ).Главные оси двух бочкообразных β-доменов флуоресцентного белка ориентированы почти под перпендикулярным углом друг к другу. Стволы β практически не контактируют друг с другом (рис. 2A) с очень маленькой общей границей раздела (150 Å 2 ). Интерфейсы минимального кальций-связывающего домена с mCerulean3 и cpVenus cd также относительно малы, покрывая только 257 и 351 Å 2 соответственно (см. Ниже). Взаимодействия в основном носят гидрофильный характер (рис. 2А).

Рис. 2 Структурные детали Twitch-2B.

( A ) Полярные взаимодействия между остатками минимального домена TnC, mCerulean3 и cpVenus cd показаны пунктирными линиями. Остатки показаны в виде палочек. ( B ) Полярные взаимодействия, опосредованные остатками (показаны в виде стержней) от линкеров между mCerulean3 и кальций-связывающим доменом (у лосося), а также взаимодействия между cpVenus cd и кальций-связывающим доменом (пурпурный) .( C ) Гидрофобные взаимодействия между остатками (показаны в виде стержней) линкеров между mCerulean3 и кальций-связывающим доменом (у лосося), а также линкером между cpVenus cd и кальций-связывающим доменом (пурпурный) с остатками (серым цветом) из ядра минимального домена TnC. ( D и E ) Крупный план области вокруг N532 Twitch-2B и мутанта N532F Twitch-2B (Twitch-6).

Линкер между mCerulean3 и кальций-связывающим доменом (V 232 ADA) образует спираль 3 10 , которая прочно удерживается на месте водородными связями основной цепи от V232 и S236 в mCerulean3 до E301 и E239 кальция. -связывающий домен (рис.2Б). Затем линкер между кальций-связывающим доменом и cpVenus cd (P 305 IYPEL) образует полтора α-спиральных витка (рис.2, B и C), карбонилы основной цепи E309 и L310 образуют водород. связывается с боковой цепью R551 (рис. 2B) cpVenus cd . Боковая цепь E309 также образует водородную связь с Y152 mCerulean3, плотно связывая три домена вместе. Остатки I306, Y307 и L310 этой короткой спирали участвуют в сети гидрофобных контактов (рис.2С). Очевидно, что скрининг оптимальных линкеров ( 8 ) привел к последовательностям со спиральными элементами, очень хорошо интегрирующимися в структуру минимального домена TnC, в то время как эти линкеры удерживают на месте донорный и акцепторный домены в основном за счет полярных взаимодействий.

Расчет эффективности FRET на основе структуры

Структура предоставила важную информацию для расчетов FRET. Во-первых, расстояние между центрами масс флуорофоров составляет 3,65 нм (рис. 1B).Затем внутри структуры флуорофоры mCerulean3 и cpVenus cd выровнены в конфигурации «голова к голове». Таким образом, мы могли точно определить относительную ориентацию дипольных моментов флуорофоров (рис. 1C; см. Материалы и методы), которые доступны из расчетов теории функционала плотности ( 15 ). С помощью этой объединенной информации мы вычислили коэффициент ориентации κ 2 , равный 1,98 (уравнение 1; Материалы и методы), и расстояние Ферстера, R 0 , равное 6.9 нм для пары FRET mCerulean3 / cpVenus cd (уравнение 3; материалы и методы). С этими параметрами, используя уравнение Фёрстера, E = R06 / (R06 + r6), теоретическая эффективность FRET, E , Twitch-2B была определена как 0,98. Эффективность FRET, экспериментально определенная с помощью декухания донора, составляет 0,78 (рис. S3A), что значительно ниже, чем эффективность, полученная на основе кристаллической структуры.

Два мономера Twitch-2B в асимметричном блоке (рис. S1A) не только имеют очень похожую конформацию (RMSD основной цепи 0.992 Å), но и очень похожие контакты упаковки кристаллов (рис. S1C). Таким образом, мы заключаем, что ориентация доменов в мономере сама по себе не ограничивается кристаллической упаковкой, а в основном внутримономерными взаимодействиями, описанными выше (рис. 2А), и, скорее всего, выбрана из пула уже существующих конформаций в растворе. Поскольку междоменные интерфейсы в мономере Twitch-2B относительно малы (рис. 2A), высокая гибкость решения может быть причиной наблюдаемого снижения эффективности FRET.Чтобы исследовать эту гипотезу, мы затем обратили внимание на передовые методы ЯМР.

ЯМР-исследование динамики биосенсора

Чтобы получить представление о возможной динамике, мы использовали парамагнитный ЯМР ( 16 ) с образцом Twitch-2B, где два сайта связывания кальция TnC были загружены диспрозием (Dy). Анизотропная магнитная восприимчивость комплекса TnC-Dy 2 индуцирует парамагнитный тензор выравнивания, который может быть определен из структуры ( 17 ) (см. Материалы и методы).Мы использовали спектрометры на 900 МГц и 1,1 ГГц, поскольку тензор юстировки квадратично зависит от магнитного поля. Если данный флуоресцентный белок является жестким по отношению к TnC, то тензор выравнивания, который он испытывает, идентичен TnC. Если, однако, флуоресцентный белок является динамическим по отношению к TnC, то это движение уменьшит тензор выравнивания первого ( 16 , 18 ). Это позволяет количественно оценить динамику флуоресцентных белков по отношению к TnC.В то время как диполярные связи усредняются в изотропном растворе из-за случайного изотропного переворачивания, парамагнитно-индуцированные тензоры выравнивания приводят к анизотропному распределению ориентации TnC и, следовательно, прикрепленных зеленых флуоресцентных белков в растворе, что приводит к неполному усреднению диполярного муфты, позволяющие наблюдать остаточные диполярные связи (RDC). Мы определили RDC метильных групп парамагнитно выровненного Twitch-2B ( 19 ) (см. Материалы и методы).Наблюдаемый диапазон RDC достаточен для измерения размера тензора выравнивания ( 20 ), так что отнесение метильных групп не было необходимым.

Мы обнаружили, что диапазон значений RDC и, таким образом, тензор выравнивания, испытываемый флуоресцентными белками, в 10 раз меньше, чем рассчитанные на основе жесткой рентгеновской структуры (рис. 3; см. Материалы и методы). Таким образом, динамика должна быть причиной несоответствия между расчетной и экспериментальной эффективностями FRET.Кристаллическая структура может быть только частью динамического конформационного ансамбля в растворе.

Рис. 3 Гистограммы парамагнитных данных RDC.

Прогнозирование RDC метильных групп в двух доменах флуоресцентного белка и TnC с использованием рентгеновской структуры (выделено пурпурным цветом). Тензор выравнивания, индуцированный двумя ионами диспрозия, связанными с TnC, является результатом трансляции тензора, полученного из кальмодулина (см. Материалы и методы). Экспериментальные RDC от парамагнитного ЯМР Twitch-2B (зеленый) и Twitch-6 (пурпурный).Дальность действия уменьшается в 10 и 5 раз для Twitch-2B и Twitch-6 соответственно.

Структурный дизайн мутанта с улучшенной эффективностью FRET

Предполагая структурную целостность отдельных доменов, мы предположили, что линкерные области являются стержнем этой динамики. На границах раздела между доменом TnC и донорным и акцепторным доменами преобладают полярные взаимодействия (рис. 2А). Мы предположили, что замена этих взаимодействий гидрофобными контактами сделает линкеры жесткими и увеличит экспериментальную эффективность FRET.С этой целью мы разработали мутацию N532F (рис. 2, D и E) на поверхности cpVenus cd , создавая новое взаимодействие с F249 кальций-связывающего домена (рис. 2D). Как и ожидалось, эта мутация вызвала существенное увеличение максимального изменения отношения FRET с 800 до 1100% in vitro (рис. S4). В кристаллической структуре этого мутанта (Twitch-6; таблица S2) боковая цепь F532 действительно связывается в гидрофобный карман, образованный боковыми цепями F249, Asp262 и Y338 (рис. 2E).В остальном структуры Twitch-6 и Twitch-2B очень похожи (RMSD 0,25 Å), что приводит к почти идентичной теоретической эффективности FRET (см. Дополнительные материалы). Благодаря этой конструкции экспериментальная эффективность FRET Twitch-6 увеличилась до 0,90, с 0,78 для Twitch-2B (рис. S3B), а диапазон RDC, измеренных с Twitch-6, удвоился по сравнению с Twitch-2B (рис. 3). . Это указывает на сужение интерфейса между доменом TnC и cpVenus cd , и, таким образом, снижение динамики между доменами является причиной увеличения FRET.

Конформационные ансамбли в решении

Определив динамику как причину снижения эффективности FRET Twitch-2B в решении, мы хотели получить представление о конформационном пространстве, возникающем в результате этой динамики. Для этой цели мы выбрали конформационные ансамбли, исследующие динамику скелета исключительно на динамических линкерных областях между доменами флуоресцентного белка и доменом TnC (см. Материалы и методы), оценивая более 1 миллиона шестичленных ансамблей против наблюдаемых RDC и эффективности FRET (Таблица 1, рис.4 и Материалы и методы). Среди всех возможных ансамблей мы выбрали тот, который лучше всего воспроизводит как экспериментальную эффективность FRET, так и диапазон RDC (Таблица 1). Этот ансамбль полностью объясняет, как гибкость неупорядоченных остатков линкерных областей приводит к наблюдаемому снижению эффективности FRET и диапазона RDC.

Таблица 1 Результаты выбора ансамбля. Рис. 4 Ансамбли белков Twitch, согласующиеся с измеренными эффективностями RDC и FRET.

Ансамбли для Twitch-2B (слева) и Twitch-6 (справа) содержат по шесть структур каждый, причем самые большие отклоняющиеся структуры показаны зеленым и красным.Состояния, которые не являются этими крайними конформациями, прозрачны.

Влияние на улучшенную конструкцию датчика FRET

Таким образом, мы получили кристаллическую структуру флуоресцентного биосенсора кальция Twitch-2B и вместе с динамикой линкеров, определенной с помощью парамагнитного ЯМР, мы количественно оценили эффективность FRET. Поскольку динамика ограничивала эффективность FRET, мы успешно сконструировали ригидифицированный мутант с увеличенным FRET. Таким образом, структурные и динамические характеристики ратиометрических датчиков FRET обеспечили принципы проектирования, которые могут быть применимы к другим системам, в которых эффекты FRET используются для восприятия сигналов.

МАТЕРИАЛЫ И МЕТОДЫ

Клонирование, экспрессия и очистка Twitch-2B и Twitch-6

Конструкция Twitch-2B была описана ранее ( 8 ). Для настоящего исследования кодирующую последовательность трехдоменного слитого белка клонировали в модифицированный вектор pET16b, кодирующий слитый белок с N-концевой меткой His 7 и расщепляющей последовательностью, распознающей вирус травления табака (TEV). Мутант Twitch-2B N532F (Twitch-6) был создан с использованием набора для сайт-направленного мутагенеза QuikChange (Agilent).Экспрессионные конструкции pET16bTEV-Twitch-2B и pET16bTEV-Twitch-6 трансформировали в штамм Escherichia coli BL21 (DE3). Экспрессию белка проводили при 303 К индукцией 0,5 мМ изопропил-β-d-1-тиогалактопиранозидом. Клетки собирали через 7 часов после индукции. Меченный селенометионином белок Twitch-2B был сверхэкспрессирован в метионин-ауксотрофном штамме E. coli B834 в минимальной среде с добавлением (+) — l-селенометионина в соответствии с группой по экспрессии белка EMBL (Европейская лаборатория молекулярной биологии) (www.embl.de).

Осадок клеток из 1 литра встряхиваемой культуры ресуспендировали в 60 мл лизирующего буфера [20 мМ трис-HCl (pH 7,9), 300 мМ NaCl, 20 мМ имидазол, 0,5 мМ фенилметилсульфонилфторид с одной таблеткой полного количества ЭДТА- свободных ингибиторов (Roche) на 100 мл лизисного буфера]. Клетки лизировали ультразвуком с последующим центрифугированием при 27000, g, и 277 К. Из супернатанта рекомбинантный белок очищали с помощью аффинной хроматографии с иммобилизованным металлом на 3 мл агарозной смолы Ni-нитрилотриуксусной кислоты (NTA) (Qiagen).Метку слияния His 7 отщепляли протеазой TEV и удаляли инкубацией с 1 мл Ni-NTA агарозной смолы. Белок диализовали против 20 мМ трис (pH 7,0) и 150 мМ NaCl. После доведения концентрации сульфата аммония в растворе белка до 1 М белок дополнительно очищали с помощью хроматографии гидрофобного взаимодействия на колонке с фенилсефарозой (GE Healthcare) объемом 10 мл. Белок элюировали с этой колонки 50-мл градиентом от 1 до 0 М сульфата аммония.Фракции, содержащие белок, объединяли и концентрировали до объема 2,5 мл с помощью концентратора для ультрафильтрации с MWCO (пороговая молекулярная масса) 30 кДа (Vivascience). Наконец, белок очищали эксклюзионной хроматографией на гель-фильтрационной колонке HiLoad 26/60 Superdex 200 мкг. Фракции пика объединяли, диализовали против 20 мМ трис-HCl (pH 7,0), 100 мМ NaCl и 5 мМ CaCl 2 , и концентрацию белка доводили до 20 мг / мл.

Флуоресцентная спектроскопия

Для спектроскопии рекомбинантного Twitch-2B in vitro белок был очищен от E.coli с использованием смолы Ni-NTA, как описано ( 6 ). Спектроскопию выполняли на спектрофотометре Cary Eclipse (Varian). Донорское расщепление Twitch-2B проводили путем расщепления Twitch-2B в связанном с кальцием состоянии в течение ночи при комнатной температуре с химотрипсином (70 Ед / мл; Sigma-Aldrich) при записи FRET. Небольшое оставшееся излучение cpVenus cd после переваривания химотрипсина было избирательно фотообесцвечено (5 мин) с помощью массива из шести светодиодов Luxeon Lumiled с пиком на длине волны 530 нм, с общей рассеиваемой мощностью 14.7 Вт и 870 люмен. Для защиты mCerulean3 от обесцвечивания использовали LP (длиннопроходный) фильтр с длиной волны 500 нм. Связанный с кальцием Twitch-6 был очень устойчив к расщеплению протеазой. Следовательно, EGTA (конечная концентрация, 5 мМ) добавляли во время переваривания химотрипсина, чтобы получить спектр деквенированного mCerulean3.

Кристаллизация, сбор данных и определение структуры

Кристаллы Twitch-2B и Twitch-6 были получены путем диффузионного смешивания паров 1 мкл раствора белка с 1 мкл раствора для лунок [0.2 M Na-формиат (pH 7,0), 5 мМ CaCl 2 и 18-20% полиэтиленгликоля 3350]. Кристаллы были подвергнуты криозащите, перенеся их в хорошо раствор с добавлением от 16 до 18% глицерина на 1 мин и быстро охладив, погрузив их в жидкий азот.

Сбор данных производился в PXII, SLS, Швейцария, с использованием детектора PILATUS 6M (Dectris). Собственные данные собирали при 100 К на длине волны 1 Å. Данные по производному селенометионина были измерены при 0,98 Å. Все данные были обработаны с помощью программного обеспечения рентгеновского детектора (XDS) ( 21 ) и масштабированы с помощью SADABS (Bruker AXS).Определение пространственной группы и статистический анализ выполняли с использованием XPREP (Bruker AXS). Фазирование выполняли с помощью AutoSol ( 22 ).

Первоначальная модель была построена с помощью AutoBuild и дважды уточнена с помощью phenix.refine ( 23 ) с промежуточным созданием модели вручную с помощью Coot ( 24 ). Окончательная модель была получена путем комбинированного ручного отслеживания (Coot) и уточнения с использованием Refmac5 ( 25 ). На графике Рамачандрана 96,69% ​​остатков располагались в предпочтительной области 2.72% в разрешенной области и 0,58% остатков были выбросами. Кристаллическая структура Twitch-6 была решена с помощью PHASER ( 26 ), используя PDB (Protein Data Bank) запись 6GEL в качестве модели поиска. Построение и уточнение модели выполнялись, как описано для Twitch-2B. Для этого мутанта 96,68% остатков попали в предпочтительную область графика Рамачандрана, 2,83% попали в разрешенную область и 0,49% были выбросами.

Расчет FRET

Фактор ориентации κ 2 может быть извлечен из структурной информации следующим образом: κ2 = (cos θT — 3 cos θD cos θA) 2 (1) где θ T — угол между эмиссионным переходом диполь донора и диполь перехода поглощения акцептора; θ D и θ A — углы между этими диполями и вектором r , соединяющим донорный и акцепторный флуорофоры ( 27 ).Ориентация дипольных моментов перехода относительно вектора связи C O (ω) в градусах ωD = 73 ° ωA = 76 ° была взята из Ansbacher et al. ( 15 ), а угловые параметры были извлечены из кристаллографических координат в угловых единицах θT = 152,95 ° θD = 149,17 ° θA = 26,79 °

Подробные расчеты поясняются в файле данных S1. Интеграл перекрытия, Дж (λ), был рассчитан из экспериментальных спектров поглощения и излучения изолированных доменов cpVenus и mCerulean3 соответственно (рис.S5) со сценарием Python, включенным в качестве дополнительной информации. J (λ) было определено как 2,052 × 10 15 M −1 см −1 нм 4 , как следует: J (λ) = ∫0∞FD (λ) εA (λ) λ4dλ = ∫0∞FD (λ) εA (λ) λ4dλ∫0∞FD (λ) dλ (2) где F D (λ) — нормированная интенсивность флуоресценции донора в диапазоне длин волн от λ до λ + Δλ. ε A (λ) — коэффициент экстинкции акцептора при λ.

Расстояние Ферстера, R 0 , можно рассчитать на основе ранее полученных экспериментальных параметров R0 = 0.211 (κ2n − 4QDJ (λ)) 1/6 (3) где Q D (0,87) — квантовый выход донора в отсутствие акцептора ( 4 ) и n , (1,33) показатель преломления водной среды.

Наконец, эффективность передачи энергии, E , может быть рассчитана как отношение скорости передачи к общей скорости распада донора в присутствии акцептора E = R06R06 + r6 (4)

Следуя этой процедуре, эффективность FRET была определена как E = 0.979, из кристаллографической структуры Twitch-2B. Эквивалентный расчет, выполненный со структурой мутанта Twitch-6, дает E = 0,983 (см. Файлы данных S1 и S2).

ЯМР-спектроскопия

Мы экспрессировали белки Twitch-2B и Twitch-6 в минимальной среде Toronto, приготовленной со 100% D 2 O и пердейтерированной d-глюкозой и дополненной предшественниками аминокислот α-кетомасляной кислотой (метил-13C , 3,3-D2) и α-кетоизовалериановой кислоты (3-метил-13C, 3,4,4,4-D4), тем самым селективно мечение атомами 13 C и 1 H только метильных групп остатки валина, лейцина и изолейцина, сохраняя при этом остальные атомы C как 12 C и протоны как 2 H ( 19 ).

Сначала изотропные спектры образцов получали в буфере A [20 мМ Mops (pH 7,0), 100 мМ NaCl и 5 мМ CaCl 2 в 100% D 2 O]. Затем белки диализовали против буфера B [20 мМ Mops (pH 7,0), 100 мМ NaCl и 10 мМ EDTA] с последующим диализом против буфера C [20 мМ Mops (pH 7,0) и 100 мМ NaCl] и, наконец, заменяли на буфер С, приготовленный на 100% D 2 O, содержащем три эквивалента диспрозия, перед измерениями ЯМР. Концентрация белка в образцах была примерно 0.5 мМ.

Образцы были протестированы с помощью экспериментов с метил-TROSY ( 19 , 28 ) (рис. S7) на частотах 900 МГц и 1,1 ГГц, а связи J и J + RDC были определены с использованием J -модулированного Эксперимент с метил-TROSY ( 29 ), изображенный на рис. S6 в виде матриц 2048 × 128 комплексных точек данных с 96 переходными процессами на приращение ( t 1 ). Общие использованные задержки модуляции J были следующими: 4, 6, 8, 10, 12, 14, 16, 18 и 20 мс (рис.S8). ЯМР-эксперименты проводились с использованием 5-мм TCI (криозонда тройного резонанса с инверсным детектированием) на спектрометре 900 МГц и 3-мм криозонда TCI на спектрометре 1,1 ГГц, оба оснащены консолями NEO (Bruker). Интенсивности (максимальная амплитуда) сигналов были извлечены с помощью CARA (компьютерное определение резонанса) ( 30 ) в экспериментах, обработанных NMRPipe ( 31 ), и проанализированы с помощью скриптов Python (рис. S8) в соответствии с Pederson et al. ( 29 ).

Расчет парамагнитного тензора

Мы взяли парамагнитный тензор из комплекса кальмодулин-IQ, связанного с диспрозием, из ( 18 ) и рассчитали суммарный тензор дважды занятого кальцийсвязывающего домена TnC. Сайт связывания кальция 1 TnC перекрывается с сайтом связывания лантанидов кальмодулина (CaM N60D). Мы повернули матрицу выравнивания с сайта связывания кальция из CaM на второй сайт связывания кальция TnC и добавили его к тензору сайта связывания кальция 1, таким образом получив общий тензор TnC.Затем этот тензор использовался для расчета RDC из парамагнитных белков Twitch ACaM = (1,05 10−31−1,92 10−322,04 10−31−1,92 10−32−1,22 10−316,46 10−322,04 10−316,46 10−321,67 10−32 ) ATwitch = (1,46 10-318,39 10-323,46 10-318,39 10-32-1,06 10-312,26 10-323,46 10-312,26 10-32-3,92 10-32)

Тензоры даны в м 3 M −1 .

Генерация ансамбля

Сначала мы индивидуально смоделировали все возможные двугранные углы основной цепи (ϕ и ψ; выборка с шагом 60 °) линкерных остатков (от Arg 229 до Gln 231 для mCerulean3 и Met от 311 до Gly 313 ​​ для cpVenus), что не привело к стерическому конфликту между одним из модифицированных доменов флуоресцентного белка и доменом TnC.Каждую из двух линкерных областей моделировали независимо. Из всех возможных комбинаций ϕ, ψ (117 649) вращение mCerulean3 дало 477 возможных конформаций, в то время как cpVenus допускало 84 конформации, обеспечивая в целом 40 086 возможных конформаций.

Во-вторых, мы случайным образом объединили возможные структуры для mCerulean-TnC и TnC-cpVenus в ансамбли из шести членов. Мы случайным образом отобрали 1 миллион шестичленных ансамблей из 40 068 возможных комбинаций ϕ, ψ линкеров между mCerulean и TnC и между TnC и cpVenus, чтобы гарантировать правильное исследование конформационного пространства Twitch.

В-третьих, мы рассчитали диапазон RDC (используя тензор, полученный, как описано выше) и FRET ансамблей и сравнили их с экспериментальными значениями, определив коэффициент качества ансамбля Qens = ∑i = 1i = 6 (RDCi − RDCeRDCe) 2+ (FRETi − FRETeFRETe) 2, где RDC i — это диапазоны распределения, субиндекс e указывает экспериментальное значение, а i указывает значение из члена ансамбля. Такое значение добротности отличается от 0, если согласования предсказанных откликов RDC и FRET от ансамбля отклоняются от экспериментальных данных, и 0 в случае полного согласия.Наконец, ансамбли были отсортированы по их Q и , и был выбран самый низкий из них.

Измерения SAXS

Данные SAXS были собраны на канале BM29 Европейского центра синхротронного излучения (ESRF) в Гренобле, Франция, с использованием автоматического устройства смены образцов ( 32 ). Белок диализовали либо против буфера A [20 мМ Mops (pH 7,0), 100 мМ NaCl и 5 мМ CaCl 2 ] (связанное с кальцием состояние), либо против буфера B [20 мМ Mops (pH 7,0), 100 мМ NaCl и 10 мМ ЭДТА] (без кальция).Перед измерением белок центрифугировали для удаления более крупных частиц. Образцы измеряли при концентрациях 2,5, 10 и 20 мг / мл. Буфер для диализа использовали для коррекции эталонного буфера. Данные собирали при 293 К с использованием длины волны 0,995 Å и расстояния от образца до детектора 2,867 м. Загружали сто микролитров каждой концентрации образца, собирали и объединяли 10 кадров. Образцы постоянно подавались в кювету, чтобы минимизировать эффекты радиационного повреждения.Изображения детектора были объединены и преобразованы в одномерные кривые рассеяния, а вклады буфера в рассеяние были вычтены с использованием программного обеспечения BsxCuBE. Дальнейшая обработка данных выполнялась автоматически с использованием онлайн-конвейера EDNA ( 33 ) для оценки качества образца и эффектов радиационного повреждения. Агрегации белков или радиационного повреждения не наблюдалось.

Данные были дополнительно проанализированы с помощью программного пакета ATSAS ( 34 ). Вкратце, первичная обработка и анализ данных проводились с использованием программ PRIMUS ( 35 ) и GNOM ( 36 ).

Теоретическое рассеяние от кристаллической структуры было рассчитано с использованием программы CRYSOL ( 37 ) (рис. S2), а молекулярные массы рассчитаны с использованием образца бычьего сывороточного альбумина в качестве стандарта.

Благодарности: Мы благодарим персонал компании SLS, X10SA за поддержку при сборе рентгеновских данных и ESRF, BM29 за поддержку при сборе данных SAXS. Мы благодарим M. Paulat, C. Schwiegk и A. Moritz за техническую помощь в производстве белка и K.Оверкамп для масс-спектров электроспрея. С. благодарит T. Gruene и G. Sheldrick за советы по уточнению кристаллической структуры и структурному анализу. К.Г. и П.Т.-М. поблагодарить R. Kuemmerle (Bruker Biospin) за измерения ЯМР на частоте 1,1 ГГц. Финансирование: Эта работа была поддержана Обществом Макса Планка и DFG SFB 870 (O.G.). П.Т.-М. был поддержан докторской стипендией Гумбольдта. Вклад авторов: P.T.-M. выполнен ЯМР. П.Т.-М. и К.Г. разработал парамагнитный метод ЯМР.П.Т.-М. рассчитаны структурные ансамбли. П.Т.-М. и С. выполнены измерения SAXS. К.Г. рассчитал FRET по рентгеновским структурам.

Добавить комментарий

Ваш адрес email не будет опубликован.