Т 16 кпп ремонт: Т 16 кпп ремонт своими руками

Содержание

Коробка передач трактора т 16 как разбирать смотреть

Помогите исправить ошибку. | Автор топика: Asarelah

Собрал самодельный трактор: задний мост от ГАЗ-69, поставил на задний мост бортовые от Т-16, коробка передач от ГАЗ-69 установлена через раздатку.

Получилось три скорости задних и одна передняя!!! Не пойму в чем причина.

Roma (Armaghan) БОРТОВОЙ РЕДУКТОР.В нем причина, через него колеса и вращаются в обратную сторону.

Roma (Armaghan) Если так то надо перевернуть редуктор(планетарку) в мосту газ-.69

Larisa (Ninon) Спасибо, Роман. А если снять раздатку и поставить кардан с коробки на мост не переворачивая редуктора???

Roma (Armaghan) А можно фото как все соеденено, а то на словах трудно понят.

Roma (Armaghan) Роздатка в принцепе не может менять направление вращения, тоесть выход с коробки и с роздатки должны вращатся в одну сторону.

Larisa (Ninon) Спасибо.

Tags: Коробка передач трактора т 16 как разбирать смотреть

Продолжаем искать причину самопроизвольного выключения передач!. Заменили валик блокировки передач, пришл…

ТРАКТОРА Т-16, Т-150, ЮМЗ, К-701, ЛТЗ, ХТЗ | Автор топика: ТРАКТОРА

Мужики, как правильно собрать коробку на К 701, и проверить??

Simion (Olen) как собрать это надо знать в двух словах не объяснишь а проверить просто — карданом присоеденил к ВОМ МТЗ и крутишь смотришь давление на всех режимах как переключается нету ли рывков скачках давления короче ЭЛЕМЕНТАРНО ВАТСОН

Евгений (Zante) Спасибо

Евгений (Zante) А если воздухом проверить?

Simion (Olen) не получиться воздух выходит в самые узкие пространства и не добиться давления в 8-9 атм. масло при этом давит на резиновые уплотнения и закрывает все щели

Евгений (Zante) Это панятно, веть видно будет работает пакет или нет

Simion (Olen) диски конечно будут смещаться но буксует или нет не понять

Евгений (Zante) А на первую передачу диск видомый добовляеш?

Евгений (Zante) Скажи ещё пожалуста, если диски буксуют, что надо делать?

Simion (Olen) просто менять диски

Евгений (Zante) А если все новые паставил и буксуют, или нет довления?

Simion (Olen) закрути клапан на пол оборота

Евгений (Zante) Спасибо

Simion (Olen) 

Вакиф (Janette) Лучше не берись без опытного наставника или слесаря, лучше на станции и опресовать после сборки.

евгений (Leosia) бустерный вал ремонтировать в гараже очень сложно даже в спец мастерских после ремонта вал ходит не очень долго ну а подтёки     если аккуратно положить фильтр и новые резинки на вал  то проблем не будет

Наталья (Delisa) Тема К 701 эксплуатация и ремонт КПП на сайте фермер. ру.

Евгений (Zante) Спасибо

Коробка передач и дифференциал Т-16М (Чертеж № 35: список …

Шестерня второй и третьей передач Т16.37.105-А. Первичный вал СШ20.37.102. … Трактора и комбайныХЗТСШТ-16МКоробка передач и дифференциал ….. скачать Прайс-Лист. Запчасти КАМАЗ · Запчасти МАЗ, ЯМЗ · Запчасти …

Ремонт коробки на Т-25 | Fermer.Ru — Фермер.Ру — Главный …

20 июл. 2010 г. — т-25,т-16,ЗиЛ-157(СМД18) …. Можно ли снять промежуточный вал в кпп т 25 без снятия … реверса подскажите куда смотреть и как определить поломку. … по кпп т25… уже раза 4 разбирал коробку передач и все время одна и … переделать коробку трактора Т-25 с реверсом старого образца …

Коробка передач трактора т-16

Коробка передач (КП) трактора Т-16 обеспечивает получение семи передач для движения вперед и одной назад. Валы в КП расположены поперек продольной оси шасси, что позволило уменьшить продольные размеры трансмиссии и осуществить передачу вращения к дифференциалу при помощи цилиндрических шестерен.

Крутящий момент передается от двигателя через коническую шестерню вала главного сцепления на ведомую шестерню 3 (рис. 58, а), установленную на шлицевом конце первичного вала коробки передач Т-16.
На шлицах первичного вала находятся подвижные блоки шестерен 6 второй и третьей передач, пятой и шестой передач 5, а также неподвижная шестерня 9 четвертой передачи. Шестерня 10 первой передачи установлена на призматической шпонке. Она находится в постоянном зацеплении с большой шестерней блока 11 заднего хода.
На вторичном валу установлены: неподвижно блоки шестерен 9 (рис. 58, б) пятой и шестой передач, второй передачи и дифференциала 17, третьей передачи 18; подвижно — шестерни четвертой передачи и заднего хода 16, первой и замедленной передач 56.

Рис. 58. Коробка передач трактора Т-16:
1 — корпус манжеты; 2, 14 — манжеты; 3 — коническое трубчатое колесо; 4, 13, 15 — подшипник; 5 — шестерня V и VI передач ведущая; 6 — шестерня II и III передач ведущая; 7 — вал первичный; 8 — колпак; 9 — шестерня IV передачи ведущая; 10 — шестерня I передачи ведущая; 11 — блок шестерен заднего хода; 12 — ось блока шестерен; 16 шестерня IV передачи ведомая и заднего xoдa; 17 — шестерня II передачи и дифференциала; 18 — III передачи ведомая; 19 — зубчатое колесо V u VI передач ведомое; 20 — вилка включения ВОМ; 21 — валик переключения IV передачи и заднего хода; 22 — валик переключения I и дополнительной передачи; 23 — ступица; 24 — ось рычага ВОМ; 25 — рычаг включения ВОМ; 26 — колонка рычага переключения передач; 27 — чехол; 28 — рычаг переключения передач; 29 — пружина; 30 — штифт; 31 — рамка блокировки; 32 — включатель блокировки; 33 — крышка; 34 — пружина стяжки; 35 — валик переключения V и VI передач; 36 — валик переключения II и III передач; 37 — вилка переключения V и VI передач; З8 — вилка переключения II и III передач; 39 — вилка переключения IV передачи и заднего хода; 40 — вилка переключения I и дополнительной передачи; 41 — крышка валиков правая; 42 — втулка распорная; 43 — шпонка; 44, 45, 54 — подшипник; 46 — крышка; 47 — гнездо уплотнения; 48, 66 — стопорные шайбы; 49 — колпак; 50 — вал вторичный; 51, 52 — втулки; 53 — манжеты; 55 — стакан подшипников первичного вала; 56 — шестерня I передачи ведомая; 57 — шарик; 58 — пружина; 59 — винт установочный; 60 — шайба; 61 — валик блокировки; 62 — кольцо; 63 — шайба упорная; 64 — ось промежуточная; 65 — гайка; 67 — подшипник нестандартный; 68 — шестерня дополнительной передачи промежуточная.

 

В нижней части корпуса трансмиссии на двух шариковых подшипниках установлена ось блока 12 шестерни заднего ходи и дополнительной передачи (рис. 58, а). На ней также закреплен блок шестерен 11 заднего хода. Шестерня медленной передачи, изготовленная вместе с осью, находится в постоянном зацеплении с промежуточной шестерней 68 (рис. 58, б).

Передачи трактора Т-16 переключаются рычагом 28, перемещающим валики 21, 22, 35 и 36 с жестко закрепленными на них вилками 37, 38, 39 и 40. Рычаг смонтирован в колонке на сферической опоре и фиксируется от проворачивания вокруг вертикальной оси штифтом 30. Движение рычага 28 ограничивается боковыми поверхностями пазов в крышке корпуса. Расположение и размеры лазов предотвращают одновременное включение двух передач.
Механизм блокировки позволяет переключать передачи только при полностью выключенном сцеплении: при нажатии на педаль сцепления валик 61 перемещается так, что его фрезерованные участки устанавливаются против валиков переключения передач, поэтому последние могут свободно двигаться в осевом направлении; при включенном сцеплении валик 61 входит в выточки валиков переключения и запирает их, не позволяя шестерням перемешаться. Ход валика блокировки ограничивается винтом 59. Валики переключения передач фиксируются в нейтральном положении шариками 57 и пружинами 58.
На верхний конец рычага 28 навернута пластмассовая рукоятка. Нижний конец рычага имеет шаровую головку, входящую в пазы валиков переключения передач. Чтобы нижняя часть рычага перемешалась в только требуемом направлении, в крышке корпуса трансмиссии имеется направляющая кулиса. Резиновый чехол 27, надетый на рычаг и удерживаемый на колонке стяжным хомутом, предохраняет детали механизма переключения передач от влаги и пыли. С целью исключения случаев запуска двигателя при включенной передаче предусмотрен механизм блокировки стартера, смонтированный в колонке переключения передач. Рычаг переключения передач трактора Т-16 28 (рис. 58, б) расположен в прорези рамки 31, жестко соединенной с осью. Из оси имеется сферический паз, куда входит шарик включателя блокировки стартера 32. При включении передачи рычагом рамка поворачивается, отключая электрическую цепь, соединенную со стартером.

См. также: Система охлаждения трактора Т-16. Регулировка ТНВД Т-16.

  • < Назад
  • Вперёд >

Трактор Т-16, Т-16 М и Т-16 МГ. Устройство, работа, характеристики и ремонт

 

 

  001  Технические характеристики трактора Т-16

  002  Трактор Т-16. Техническое обслуживание

  003  Трактор Т-16. Смазка подшипников

  004  Трактор Т-16. Работы по обслуживанию

  005  Трактор Т-16. Каркас

  006  Трактор Т-16. Управление сцеплением, ВОМ и торможением

  007  Трактор Т-16. Рабочее место оператора

  008  Трактор Т-16. Двигатель Д-16

  009  Трактор Т-16. Картер дизеля Д-16

  010  Трактор Т-16. Головка блока цилиндров дизеля Д-16

  011  Трактор Т-16. Картер маховика двигателя Д-16

  012  Трактор Т-16. Шатун дизеля Д-16 и вкладыши шатунных подшипников

  013  Трактор Т-16. Двигатель Д-21А

  014  Трактор Т-16. Уравновешивающий механизм двигателя Д-16

  015  Трактор Т-16. Коромысла клапанов и распределительные шестерни дизеля Д-16

  016  Трактор Т-16. Система пуска дизельного двигателя Д-16

  017  Трактор Т-16. Устройство системы питания дизельного двигателя, топливный бак дизеля Д-16

  018  Трактор Т-16. Топливный насос высокого давления (ТНВД) дизеля Д-16

  019  Трактор Т-16. Плунжерная пара топливного насоса дизеля Д-16

  020  Трактор Т-16. Подкачивающий топливный насос, регулятор дизеля Д-16

  021  Трактор Т-16. Топливопровод высокого давления дизеля Д-16

  022  Трактор Т-16. Топливный насос ТНВД НД-21 дизеля Д-16

  023  Трактор Т-16. Регулятор давления ТНВД дизеля Д-16

  024  Трактор Т-16. Подкачивающий топливный насос дизеля Д-16

  025  Трактор Т-16. Форсунка и воздухоочиститель дизеля Д-21А

  026  Трактор Т-16. Система смазки дизеля Д-16

  027  Трактор Т-16. Масляный насос трактора дизеля Д-16

  028  Трактор Т-16. Фильтр грубой очистки масла дизеля Д-16

  029  Трактор Т-16. Поддон картера двигателя и редукционный клапан масляного насоса дизеля Д-16

  030  Трактор Т-16. Система смазки двигателя Д-21А

  031  Трактор Т-16. Система охлаждения дизеля Д-16

  032  Трактор Т-16. Техническое обслуживание дизелей (Д-16, Д-21А)

  033  Трактор Т-16. Замена коренных и шатунных вкладышей дизеля Д-16, Д-21А

  034  Трактор Т-16. Неисправности форсунок дизеля Д-16, Д-21А

  035  Трактор Т-16. Регулировка насоса НД 21/2-4 дизеля Д-16, Д-21А

  036  Трактор Т-16. Обслуживание системы смазки дизеля Д-16, Д-21А (смена масла)

  037  Трактор Т-16. Возможные неисправности двигателя Д-16

  038  Трактор Т-16. Трансмиссия

  039  Трактор Т-16. Коробка передач

  040  Трактор Т-16. Дифференциал

  041  Трактор Т-16. Конечные передачи

  042  Трактор Т-16. Тормоза

  043  Трактор Т-16. Техническое обслуживание трансмиссии

  044  Трактор Т-16. Ходовая часть

  045  Трактор Т-16. Передний мост

  046  Трактор Т-16. Рулевое управление

  047  Трактор Т-16. Обслуживание ходовой части

  048  Трактор Т-16. Техническое обслуживание рулевого управления

  049  Трактор Т-16. Замена масла

  050  Трактор Т-16. Неисправности рулевого управления

  051  Трактор Т-16. Электросхема трактора

  052  Трактор Т-16. Генератор (Г-80 В)

  053  Трактор Т-16. Реле-регулятор

  054  Трактор Т-16. Регулятор напряжения

  055  Трактор Т-16. Стартер

  056  Трактор Т-16. Схема электрооборудования трактора Т-16М

  057  Стартер СТ-222 трактора Т-16

  058  Трактор Т-16. Обслуживание электрооборудования

  059  Трактор Т-16. Проверка генератора

  060  Трактор Т-16. Проверка стартера

  061  Трактор Т-16. Обслуживание фар

  062  Трактор Т-16. Неисправности электрооборудования

  063  Трактор Т-16. Рабочее оборудование

  064  Трактор Т-16. Насос гидросистемы

  065  Трактор Т-16. Гидравлический распределитель

  066  Трактор Т-16. Топливный бак

  067  Трактор Т-16. Обслуживание гидравлической системы

  068  Трактор Т-16. Вал отбора мощности

  069  Трактор Т-16. Агрегатирование с с/х машинами

  070  Культиватор-растениепитатель навесной КРС-2,8А

  071  Волокуша навесная фронтальная ВНШ-3,0

  072  Трактор Т-16. Карданный вал

  073  Обкатка нового трактора Т-16

  074  Трактор Т-16. Изменение (регулировка) колеи

  075  Трактор Т-16. Условия безопасности при работе с трактором

  076  Трактор Т-16. Устойчивое питание теплогенераторов ТГ-1 и ТГ-2,5

  077  Трактор Т-16. Агрегат очистки зубовых борон

  078  Стогометатель, сажалка СШР-0,5

  079  Свойства почвы технологические

  080  Гидро-подкормщик 188181

  081  Дистиллятор воды для трактора Т-16

 

 

 

 


 

Переключения передач трактора Т-28ХЗ | Ремонт тракторов и спецтехники

Переключения передач трактора Т-28ХЗ

Поперечный валик блокировки расположен сбоку от защелок. Они имеют проточки, а на валике блокировки прорезаны лыски. Когда муфта сцепления включена, валик блокировки, входящий в проточки защелок, не дает им подняться и этим препятствует переключению передач. При выключении муфты валик блокировки по­ворачивается стороной, на которой имеются лыски, к защелкам и освобождает их.

Рис. 51. Схема переключения передач трактора Т-28ХЗ.

На конце валика блокировки приварен рычажок, соединенный тягой с педалью муфты сцепления.

Какова основная особенность полунезависимого привода вала отбора мощности тракторов Т-28, Т-28Х и Т-28ХЗ?

Для включения зависимого привода вала отбора мощности нужно выжать педаль сцепления, перевести рычаг в нужное положение и плавно отпустить педаль сцепления. Если при этом положении рычага выключить муфту сцепления, трактор и вал отбора мощности оста­новятся одновременно.

Для включения полунезависимого привода вала от­бора мощности нужно сначала включить зависимый привод и привести во вращение механизмы машины (орудия), соединенные с валом отбора мощности. Затем резким рывком рукоятки вверх, без задержки на ней­трали, включить полунезависимый привод с одновремен­ным выключением муфты сцепления. После этого муфта сцепления служит для приведения в движение и останов­ки только трактора, а вал отбора мощности вращается независимо от нее.

Нельзя включать полунезависимый привод непосред­ственно из нейтрального положения.

Как устроена коробка передач трактора Т-40 и как управляют ею?

На заднем конце вала муфты сцепления закреплена ведущая коническая шестерня механизма реверса. Рас­положение валов коробки поперечное. Скользящие и неподвижные шестерни установлены на первичном и вто­ричном валах и на валу зад­него хода и оси промежуточ­ной шестерни.

Схема переключения пере­дач представлена на рисун­ке 52.

Устройство механизма переключения примерно такое же, как на самоходном шасси Т 40.

Каковы основные осо­бенности коробки передач тракторов MT3-5J1 и МТЗ-5М?

Коробка передач тракторов МТЗ-5Л и МТЗ-5М, а также МТЗ-5ЛС, МТЗ-5МС и Т-50В относится к типу «умножен­ных». Она состоит из двухско- ростного редуктора и пятиско — ростной коробки передач.

Любая из пяти ступеней передач переднего хода и пе­редача заднего хода может быть включена как при низкой ступени редуктора, так и при высокой. Таким образом, коробка передач обеспе­чивает 10 передач переднего хода и две передачи задне­го хода.

Как переключаются передачи у тракторов

Сначала рычагом пере­ключения выбирают нуж­ную ступень редуктора, а затем этим же рычагом включают передачу. Схема переключения показана на рисунке 53.

Ремонт коробки передач Т-170 Б-170 ЧТЗ


Коробка т 40

________________________________________________________________________

Коробка передач КПП трактора Т-40

Установленная на тракторе Т-40 коробка передач (рис. 25) предназначена для изменения скорости и направления движения трактора.

Механическая, восьмискоростная, четырехходовая с поперечным расположением валов коробка передач трактора Т-40 состоит из конической передачи с механизмом реверса, ходоуменьшителя, валов и шестерен, механизма переключения, механизма блокировки передач, главной передачи с дифференциалом и механизмом блокировки дифференциала.

Рис. 25. Коробка передач КПП трактора Т-40

1 — корпус трансмиссии; 2, 21, 26, 29, 32 — подшипники; 3 — вторичный вал; 4 — ходоуменьшитель; 5—крышка ходоуменьшителя; 6 — коническая шестерня реверса; 7 — трубопровод маслоприемника; 8, 15 — маслоприемник; 9 — рычаг переключения реверса и ходоуменьшителя; 10 — ведущая коническая шестерня, 11 — вал муфты главного сцепления; 12— муфта реверса; 13 — пробка-сапун; 14 — вилка переключения реверса; 16 — ведомая коническая шестерня; 17 — кулиса; 18—рычаг переключения передач; 19 — чехол; 20 — валик механизма переключения; 22 — первичный зал; 23 — блок шестерен заднего хода; 24— крышка корпуса трансмиссии; 25 — педаль блокировки дифференциала; 27 — вал-шестерня замедленной передачи; 28— промежуточная шестерня замедленной передачи; 30, 31 — стаканы подшипников; 33 — шток; 34 — вилка; 35 — полуось; 36 — зубчатая муфта блокировки дифференциала; 37 — дифференциал; 38 — ведомая цилиндрическая шестерня промежуточной передачи; 39— пробка сливного отверстия; 40 — качающаяся рамка; 41 — выключатель

Коническая передача КПП трактора Т40 с механизмом реверса предназначена для передачи вращения и крутящего момента от дизеля к первичному валу, валу реверса или ходоуменьшителю. Конические шестерни 6, 10 и 16 имеют круговой зуб и в процессе эксплуатации не требуют регулировок до их выбраковок.

Ведущая шестерня 10 конической передачи смонтирована в расточке передней части корпуса трансмиссии трактора Т-40 и вращается в переднем (шариковом) и заднем (роликовом) подшипниках.

Ведомая шестерня 16 коробки передач установлена в левой части первичного вала на двух шарикоподшипниках. Ведомая коническая шестерня 6 реверса смонтирована также в левой части корпуса трансмиссии.

Между ведомыми шестернями на шлицах первичного вала КПП трактора Т-40 установлена муфта 12 реверса, которая может занимать одно из трех положений: находиться в зацеплении с ведомой конической шестерней 16 переднего хода, с ведомой конической шестерней 6 реверса или валом ходоуменьшителя.

Коническую передачу трактора Т-40 заменяют комплектно, т. е. все шестерни — ведущую и ведомую.

Вначале устанавливают ведущую коническую шестерню 10, выдержав расстояние от торца шестерни до оси первичного вала 40 ± 0,1 мм. Во время регулировки необходимо увеличивать или уменьшать число прокладок, устанавливаемых под стакан подшипника.

Затем устанавливают ведомую коническую шестерню 16 так, чтобы зазор в зацеплении зубьев шестерен был в пределах 0,25—0,6 мм. Зазор регулируют путем установки или удаления прокладок из-под стакана 30 подшипника. Коническую шестерню реверса устанавливают аналогично ведомой конической шестерне.

Ходоуменьшитель трактора Т-40

Ходоуменьшитель трактора Т40 предназначен для получения дополнительного ряда замедленных скоростей, что позволяет использовать его с сельскохозяйственными машинами и орудиями, требующими пониженных скоростей движения. Установлен он с левой стороны трактора, в расточку под стакан конической шестерни реверса.

Конструкция ходоуменьшителя трактора Т-40 выполнена в виде отдельного узла и представляет собой зубчатую передачу с внешним и внутренним зацеплением. Передаточное число ходоуменьшителя 2,75.

Рис. 26. Ходоуменьшитель трактора Т-40

1 — крышка с маслоподводящей трубкой; 2 — ведомая шестерня; 3 — сателлит; 4 — стакан; 5 — ось педали муфты сцепления ВОМ; 6 — маслоприемник с трубкой; 7 — коронная шестерня; 8 — первичный вал; 9 — муфта; 10 — коническая шестерня; 11 — ведущий вал; 12 ~ солнечная шестерня; 13 — водило; 14 — регулировочные прокладки

Ходоуменьшитель трактора Т40 (рис.

26) работает следующим образом. Солнечная шестерня 12, соединенная шлицами с конической шестерней 10 реверса, вращает сателлиты 3, расположенные в неподвижном водиле 13.

Сателлиты передают вращение шестерне 2, которая через шлицевое соединение вращает ведущий вал 11 ходоуменынителя. Далее вращение передается через подвижную муфту 9 к первичному валу 8 коробки передач.

Ходоуменьшитель рассчитан на работу трактора с тяговым усилием не более 9 кН (900 кгс). Пятую и шестую передачи включать не рекомендуется во избежание повышенного износа шестерен этих передач. Соответствующие скорости можно получить на прямых передачах.

Валы и шестерни коробки передач трактора Т-40 предназначены для получения определенного ряда скоростей и изменения направления движения трактора (см. рис. 25).

Первичный вал КПП Т40 вращается в двух шарикоподшипниках, расположенных в расточке корпуса трансмиссии и стакане 30. На шлицах первичного вала установлены два скользящих блока: блок ведущих шестерен пятой и шестой и блок второй и третьей передач, а также две неподвижные шестерни четвертой и первой передач.

На вторичном валу КПП трактора Т-40 установлены неподвижные шестерни (шестой передачи, блока ведомых шестерен второй и пятой передач, блока ведомых шестерен передачи к дифференциалу и третьей передачи и две подвижные шестерни — шестерни четвертой передачи и заднего хода и шестерни первой и замедленной передач.

При перемещении одной из подвижных шестерен с помощью механизма переключения включается требуемая передача. При включении передачи заднего хода или замедленной вводятся в зацепление дополнительные шестерни 23 и 28, установленные в нижней части корпуса трансмиссии.

Установку вторичного вала 3 регулируют при замене вала прокладками путем установки или удаления их из-под стакана 31 подшипника, выдержав расстояние от оси ВОМ до торца вторичного вала 35+0-34 мм.

Механизм переключения передач КПП Т-40 состоит из валиков переключения с закрепленными на них вилками. Валики имеют кольцевые канавки, в которые входят шарики-фиксаторы. Валики с помощью рычага переключения могут перемещаться для включения передач.

Механизм блокировки коробки передач трактора Т-40 (рис. 27) предназначен для устранения случаев неполного включения шестерен и их самовыключения.

Он состоит из шариков-фиксаторов 13 с пружинами 14 и валика 2 блокировки.

Рис.27. Механизм блокировки коробки передач КПП трактора Т-40

1 — валик переключения передач; 2 — валик блокировки; 3, 11 — рычаги блокировки; 4 — установочный винт; 5 — педаль муфты главного сцепления; 6 — тяга блокировки; 7 — гайка; 8 — вилка тяги; 9 — рычаг переключения передач; 10 — палец; 12 — кулиса; 13 — шарик; 14 — пружина

При нажатии на педаль муфты главного сцепления, что необходимо при включении требуемой передачи, перемещается и валик блокировки до тех пор, пока фрезерованные пазы на нем не установятся против валиков переключения.

В таком положении каждый валик переключения удерживается только шариковым фиксатором и может быть перемещен с помощью рычага переключения.

После этого педаль муфты сцепления возвращается в исходное положение, а валик блокировки своей цилиндрической частью входит в кольцевую проточку валиков переключения, не допуская их перемещения.

Регулировать механизм блокировки КПП Т-40 в процессе эксплуатации тракторов не требуется, за исключением случаев замены деталей или полной его разборки.

В этих случаях после установки свободного хода регулируют педали главного сцепления трактора Т-40 в следующей последовательности:

— устанавливают в нейтральное положение рычаг переключения передач и отпускают педаль глашюй муфты, т. е. оставляют муфту включенной;

— расшплинтовывают палец 10 вилки 8 и снимают ее с рычага 11 блокировки;

— нажимают на рычаг 11 блокировки, переместив его в крайнее заднее положение, которое соответствует включенному положению муфты;

— отвертывая вилку 8, подбирают такую длину гиги, чтобы при крайнем заднем положении рычага соединить вилку тяги. После регулировки устанавливают и зашплинтовывают палец вилки.

Кроме упомянутого механизма в коробке передач трактора КПП Т40 установлен другой механизм блокировки, исключающий пуск дизеля при включенной передаче.

Этот механизм состоит из выключателя 41 (см. рис. 25) и качающейся рамки 40 у смонтированных в корпусе управления переключением передач.

При включении одной из передач вместе с рычагом поворачивается рамка с осью, замыкая через выключатель обмотку магнето пускового агрегата на «массу» или размыкая цепь включения стартера дизеля при электростартерном пуске.

В процессе эксплуатации нельзя допускать ослабления мест крепления провода и его обрыва.

Редуктор главной передачи и дифференциал трактора Т-40

Главная передача и дифференциал предназначены для передачи колесам трактора Т-40 вращения и крутящего момента с разными угловыми скоростями.

Главная передача (редуктор) трактора Т-40 состоит из пары цилиндрических прямозубых шестерен.

Дифференциал — простой, двухсателлитный с коническими шестернями, расположенными в ступице дифференциала.

При прямолинейном движении трактора, когда сопротивление на ведущих колесах оди¬наково, правая и левая ведомые шестерни дифференциала вращаются с одинаковой угловой скоростью.

С изменением сопротивления на ведущих колесах или во время поворота трактора одна из ведомых шестерен замедляет вращение, другая — ускоряет, обкатываясь на конических шестернях-сателлитах.

Регулировка шестерен дифференциала в процессе эксплуатации не требуется.

Механизм блокировки дифференциала трактора Т40 (рис. 28) позволяет передавать вращение с одинаковой частотой левой и правой полуосям, что необходимо во время преодоления трактором препятствий.

Рис. 28. Механизм блокировки дифференциала трактора Т-40

1 — педаль блокировки дифференциала; 2 — болт; 3 — гайка; 4 — рычаг штока; 5 — шток; 6 — направляющая штока; 7 — пружина блокировки; 8 — ось качания вилки; 9 — шестерня дифференциала; 10 — вилка блокировки; 11 — муфта; 12 — полуось

Механизм блокировки дифференциала трактора Т-40 регулируют только при нарушении регулировки в такой последовательности:

— отвертывают гайку 3, ввертывают регулировочный болт 2 в педаль 1 снизу;

— включают муфту 11, нажав ногой на педаль 1 до отказа;

— отвертывают регулировочный болт 2 до упора головки в крышку коробки;

— отпускают педаль 1 блокировки и отвертывают болт 2 еще на один оборот.

В таком положении регулировочный болт сверху надежно закрепляют гайкой 3.

Надежность и продолжительность работы механизма блокировки зависят от его правильной эксплуатации, поэтому при работе на тракторе Т-40:

— Используют блокировку только для преодоления препятствий при увеличенном буксовании одного из ведущих колес, для чего выключают муфту главного сцепления, нажимают ногой на педаль блокировки и включают сцепление;

— Не делают поворотов на тракторе при включенной блокировке.

Запрещается включать блокировку дифференциала при включенной муфте сцепления.

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

Технические характеристики

Трактор Т-40 является самостоятельным техническим средством, управляемым оператором. Вместимость кабины — один человек. Устройство может работать с любым типом навесок, подходящих и для более ранних моделей (Т25, Т30, Т35). Очевидное преимущество — доступность и возможность приобретения модели в хорошем состоянии, несмотря на завершение производства более 20 лет назад.

Вес и габариты устройстваВес Т-40 равен 2595 кг. Габаритные размеры трактора Т-40 составляют: 3660/1620/2100 мм.
Тип двигателяВ зависимости от модификации трактор может быть оснащен четырехтактным дизельным двигателем с воздушным охлаждением, модель двигателя Д37 или Д144. Д37 обладает мощностью 37 лошадиных сил, Д144 — мощностью в 50 лошадей.
Коробка передачТип КПП: семиступенчатая, четырехходовая. Расположение валов КПП — поперечное. Редуктор размещен сразу за муфтой сцепления.
Ходовая часть и трансмиссияТрансмиссия механическая, реверсивного типа. С помощью этой составляющей системы управления трактор может свободно перемещаться на любой скорости, двигаясь как вперед, так и назад, не снижая при этом продуктивность и производительность. Валы отбора мощности расположены сзади и сбоку, работают независимо друг от друга в нескольких режимах. На Т-40 можно установить ходоуменьшитель механического или гидрообъемного типа.
КабинаТ-40 оснащен кабиной несъемного типа, вместимость — один человек. Обзорность — четырехсторонняя. Присутствуют зеркала заднего вида. Несущая система — полурамная.
Управление тракторомЗапуск трактора Т-40 осуществляется при помощи электростартера. Т-40 принадлежит к 0,9 тяговому классу. Тормоза трансмиссионного типа, поворот осуществляется за счет движения передних колес. Задние колеса на жесткой подвеске, передние — на пружинной.
Типы привода и навесного оборудования, с которым может работать трактор Т-40В зависимости от модификации устройство может быть полноприводным или заднеприводным. Работает со всем спектром навесного оборудования от предыдущих моделей и моделей, идентичных по весу, состоящих с Т-40 в одном тяговом классе, например, «Беларусь». Наличие пневмооборудования — не предусмотрено. К трактору можно также подключать 12-вольтовое электрооборудование.

Параметры и устройство КПП

Тракторы Т-40 оснащались восьмиступенчатыми механическими коробками. Схема коробки передач трактора Т 40 включает в себя следующие элементы:

  1. Ходоуменьшитель. Обеспечивает работу трактора на пониженных скоростях, что требуется при использовании некоторых видов сельскохозяйственного оборудования. Представляет собой зубчатую передачу, соединенную с конической шестерней реверса и с валом ходоуменьшителя через шлицы. Устанавливается с левой стороны трактора в расточку под стакан конической шестерни реверса.
  2. Реверс с конической передачей. Обеспечивает движение задним ходом. Представляет собой редуктор, переключающий шестерни зацепления в конической передаче. В результате обеспечивается изменение направления и скорости движения ведомого вала.
  3. Коническая передача также передает крутящий момент и направление вращения от двигателя к первичному валу и ходоуменьшителю. Ведущая шестерня располагается в передней части блока трансмиссии, ведомая — на первичном валу.
  4. Главная передача и дифференциал. Передают колесам крутящий момент и задают разные угловые скорости при поворотах. Представляет собой две цилиндрические шестерни с прямыми зубьями. При повороте одна ведомая шестерня ускоряет вращение, а вторая замедляет.
  5. Механизм блокировки дифференциала. Обеспечивает равную частоту вращения обоим полуосям, при движении по сильно пересеченной местности.
  6. Шестерни и валы «отвечают» за изменение скорости и направления движения. Оснащены механизмом переключения, посредством которого и происходит управление. Ключевые валы — первичный и ведущий. Управление осуществляется зацеплением нужной подвижной шестерни с неподвижной. Механизм переключения передач представляет собой валики с вилками, смещающими шестерни.
  7. Механизм блокировки КПП. Предотвращает неполное включение шестерен. Состоит из валика и подпружиненных шариков-фиксаторов. При работе блокиратора валик входит в кольцевую проточку валиков переключения и предотвращает их перемещение.
  8. Конечная передача трактора. Уменьшает частоту вращения полуосей ведущих колес. Представляет собой две цилиндрические шестерни с прямыми зубьями. Ведущая шестерня устанавливается в расточках блока, ведомая — на полуоси колеса.

Типичные неисправности механизма выбора передач ГАЗ-53/3307 и их устранение

Механизм выбора передач — важная часть КПП, любые ее неисправности критично влияют на работу всего агрегата, поэтому проблемы с данным механизмом необходимо решать без замедления.

Для механизма выбора передач характерны две основных проблемы:

  • ?Вылет? одной или нескольких передач — обычно это является прямым следствием деформации или износа вилок, ослабления крепления вилок на штоках, а также износа самих штоков;
  • Затруднение при включении или выключении передач вероятнее всего это происходит вследствие заклинивания фиксаторов или других деталей, причем это опять же происходит вследствие деформации или износа компонентов.

Также может наблюдаться ослабление предохранителя включения передачи заднего хода, неисправность выключателя света заднего хода, поломка или износ сухарей на вилках и ряд других неисправностей.

В любом случае при неисправности КП ее следует демонтировать с грузовика, разобрать и произвести дефектовку. Все изношенные, деформированные и поврежденные детали следует заменить.

Для поддержания механизма выбора передач КП ГАЗ-53/3307 в рабочем состоянии следует соблюдать рекомендации по эксплуатации трансмиссии и выполнять регулярное ТО коробки. При бережном отношении к коробке, при использовании рекомендованного трансмиссионного масла и при своевременном устранении неисправностей КПП будет работать долго и надежно.

Выбор трансмиссионного масла

При длительной эксплуатации транспортного средства с коробкой передач ГАЗ-3307, водитель может столкнуться с такой проблемой, как течь масла из КПП. В ряде случаев это может быть связано с тем, что имеется ослабленная затяжка болтов крепления, произошел износ сальника, имеется трещина в картере. Деформированные запчасти должны быть заменены, добавлено новое масло.

Замена трансмиссионного топлива является видом ремонта КПП. Какое масло заливать в механическую коробку передач на ГАЗ-3307? Добавлять в КПП рекомендуется трансмиссионную жидкость ТАП-15в, требуется около 6 литров. Периодичность замены составляет 60000 км пробега.

Таким образом, грузовой автотранспорт ГАЗ-3307, отличается хорошей проходимостью, оснащен надежной механической коробкой, которая рассчитана на долгий эксплуатационный ресурс. Периодически следует осуществлять ее техническое обслуживание, менять трансмиссионное масло, чтобы снизить риск появления серьезных поломок в автомобильной системе.

В грузовых автомобилях ГАЗ применяется классическая трансмиссия с ручным управлением, причем коробка передач за последние полвека почти не претерпела изменений. Важную роль в данной КП играет механизм выбора передач — об этом узле трансмиссии, его роли, конструкции, работе и ремонте читайте в статье.

Установка корзины сцепления на тракторе Т 16

Установка корзины сцепления на тракторе т 16 производится со снятием двигателя. Сняв двигатель, мы видим корзину сцепления. Но это только начало. В нашем случае у неё отломилась лапка, а на диске сцепления ослабли заклепки, крепящие  шлицевую ступицу диска.

Устанавливая новую корзину и диск, их необходимо отцентровать относительно опорного подшипника находящегося внутри коленчатого вала. Как правило, это делается при помощи первичного вала.

 

Раньше мне никогда не приходилось ремонтировать именно этот трактор. Конструктивно он очень похож на т-40, но это только видимая схожесть. И поэтому при его ремонте пришлось встретиться с трудностями. Нам необходим первичный вал со стаканом, который вставляется в картер КПП. Но снять его мы не смогли, так как стакан имеет прорезь.

Которая позволяет ведущей шестерни вала отбора мощности войти в зацепление с ведомой шестерней вала отбора мощности, именно эта шестерня и не даёт выйти стакану из корпуса КПП. Для того чтобы снять шестерню нужно вынуть вал отбора мощности.

 

В картере сцепления под первичным валом имеется пластиковая крышка, под которой находится опорный подшипник вала отбора мощности и стопорное кольцо удерживающее вал отбора мощности.

 

Естественно чтобы его вынуть необходимо, снять карданный вал привода гидравлического насоса и переднюю крышку вала отбора мощности.

А вот  открутить заднюю пластиковую крышку вала отбора мощности не позволяет полуось. И она снимается вместе с бортовой передачей и корпусом ленточного тормоза.

 

И так разобрав половину трактора нам всё таки удалось снять первичный вал . заменить выжимкой подшипник, сальники и от центровать корзину сцепления и диск сцепления.

Снятие и установка корзины сцепления на тракторе Т 16 связана с большими неудобствами. Но иначе снять её не получится. Когда этого трактора нет на базе. Вроде бы он и ненужен. Но стоит ему появиться как находится сразу для него работа.

Ремонт Коробки Передач (КПП) в Мелитополе

 

Осуществляем капитальный и текущий ремонт коробок передач (КПП)

основных моделей грузового автотранспорта ГАЗ, МАЗ, ЗиЛ, КамАЗ, тракторов МТЗ, ЮМЗ Т-16, Т-25, Т-40, Т-150К, Т-156, К-701 комбайнов, различной спецтехники

Первые признаки неисправности КПП указывающие на необходимость ремонта: 

  • передачи не включаются или же переключение затруднено;

  • посторонние шумы коробки передач в нейтральном положении;

  • присутствует неприятный запах гари;

  • передачи проскальзывают;

  • наблюдается утечка масла;

  • при переключении передач слышен скрежет или ощущаются толчки;

  • слышен хруст при переключении передач, выбивание передач;

  • повышенный люфт кулисы переключения передач 

 Качественный ремонт КПП – достаточно сложный процесс,  требующий знаний, опыта и специального оборудования.

Некоторые механизаторы  сами пытаются устранять неполадки, но не всегда это заканчивается успехом из-за

отсутствия оборудования, навыков и необходимого набора запчастей.

 В RDA-Group благодаря высокому профессионализму мастеров, многолетнему опыту и наличию собственного склада запчастей,

ремонт проводится качественно и в оговоренные с заказчиком сроки с гарантией до 18 месяцев.

 С помощью современного оборудования мастера быстро определят самые незначительные  неисправности, а использование

специальных профессиональных инструментов позволит быстро найти поломку, определить причину и провести ремонт КПП

в кратчайшие сроки.

Стоимость ремонта, перечень работ и сроки согласовываются с заказчиком сразу после дефектовки.

Возможно проведение текущего или капитального ремонта коробки передач.

Производим ремонт реверса Т-40 и реверса Т-25 имеющих реверсивные КПП.

При любом ремонте вначале проводится чистка и мойка всех деталей, регулировка тяг, замена сальников, подшипников,

шестерен и механизма кулисы, замена масла.

После проведения всех ремонтных работ коробку передач собирают и проводят регулировку механизмов и доводку всех рабочих

параметров на специализированном стенде.

У наших мастеров  большой опыт работы по ремонту коробок передач МТЗ-80, Т-150, ЮМЗ-6 и др.  

Высокое качество выполненных работ и соблюдение оговоренных сроков гарантируем.

 

Почему выгодно обращаться в RDA-Group:

Любая техника со временем требует ремонта и возникает вопрос

приобретения запчастей.

Лучшим выбором здесь являются два варианта:

— в ближайшем магазине сельхоз запчастей в регионе, где выбор

необходимых запасных частей часто ограничен; 

— в интернете, где масса предложений по самой «выгодной цене», (и где хуже

товар и более сомнительная фирма “однодневка” — там ниже цены).

И поэтому самый оптимальный вариант — это приобрести все необходимое

в одном месте — это  в интернет-магазине RDA-Group.

Наши преимущества:

  • возможность в любое время (круглосуточно) и где бы вы не находились
    сделать заказ через сайт,  не выходя даже из дома; 

  • низкие цены — мы работаем напрямую с производителями;

  • только оригинальная продукция с официальной гарантией;

  • наличие собственного склада с большим количеством товара;

  • оперативная отгрузка товара в день заказа любой транспортной
    компании на ваш выбор;

  • любая удобная форма оплаты товара, в том числе работаем с НДС;

  • экспертность — наш более чем 12 летний успешный опыт в сфере
    сельхоз запчастей всегда будет вам полезен. 

  • если на сайте нет какой-то необходимой вам позиции, то можете
    позвонить нашему менеджеру и сделать свой заказ. 

 Для вашего удобства мы также производим ремонт (восстановление) узлов

и агрегатов различной техники с использованием оригинальных запчастей,

имея для этого все необходимое оборудование и опытных специалистов. 

Понимая, что техника не должна простаивать на ремонте мы создали хороший

оборотный фонд.  Сотрудничая с нами, вы получите качественные запчасти

для долгой и безотказной работы вашей техники.

 Для получения более подробной информации обращайтесь

по тел.+38 (068) 516-70-82

границ | GDPLichi: классификатор генов, связанных с репарацией повреждений ДНК, для прогнозирования реакции ингибиторов контрольных точек аденокарциномы легких

Введение

Рак легких занимает второе место по заболеваемости и первое место по смертности среди злокачественных новообразований во всем мире (1), из которых аденокарцинома легких является наиболее распространенным подтипом (2). Прогноз распространенного и рецидивирующего рака легкого обычно неблагоприятный, поскольку большинство стандартных методов лечения цитотоксическими противоопухолевыми препаратами имеют лишь ограниченный терапевтический эффект.В последние годы, благодаря лучшему пониманию регуляции иммунного ответа, терапия ингибиторами иммунных контрольных точек (ICI) показала улучшение показателей выживаемости при многих видах рака, включая немелкоклеточный рак легкого (NSCLC). Принцип ICI заключается в реактивации иммунных клеток с помощью специфических антител против ингибирующих сигнальных молекул, таких как CTLA-4 и PD-1, экспрессируемых на опухолевых и иммунных клетках. В настоящее время одобренные препараты анти-CTLA-4 (ипилимумаб), анти-PD-1 (ниволумаб и пембролизумаб), анти-PD-L1 (атезолизумаб, авелумаб и дурвалумаб) и их комбинации показали значительные улучшения в лечении запущенных Пациенты с НМРЛ (3–6).Аденокарцинома легкого составляет 80% НМРЛ, и на нее больше всего влияет терапия ИКИ. Тем не менее, также сообщалось, что все еще были только пациенты с частичной LUAD, реагирующие на ICI (7)

Экспрессия PD-L1 широко использовалась в качестве прогностического маркера ответа ICI, но чувствительность и специфичность не очень постоянны из-за разных антител. и пороговые значения, используемые для теста PD-L1 (3, 8, 9). Между тем, экспрессия PD-L1 не может точно отражать сложное иммунное микроокружение опухоли (10).Недавние исследования также показали, что бремя опухолевых мутаций (TMB) тесно связано с эффективностью ответа на ICI (11, 12) и может также использоваться в качестве прогностического маркера эффективности лечения ICI. Как и для PD-L1, пороговое значение TMB является спорным (13–15). Кроме того, ТМБ сам по себе не вызывает непосредственно процессинг неоантигена молекулами класса главного комплекса гистосовместимости (МНС), поэтому точность ТМБ как предиктора для лечения ICI невысока. Неоантиген, экспрессируемый на опухолевых клетках, является одной из основных мишеней для эффективного противоопухолевого Т-клеточного ответа (16), но его трудно идентифицировать.Таким образом, идентификация новых маркеров, которые могут эффективно и точно предсказать ответы ICI, является актуальной. Одной из перспективных областей для этого исследования является репарация повреждений ДНК (DDR). Чтобы обеспечить целостность генома, клетки активируют пути репарации повреждений ДНК для восстановления генетических повреждений (SNP, Indel и т. д.) в процессе репликации ДНК. DDR состоит из восьми путей, включая репарацию с несоответствием (MMR), репарацию эксцизией оснований (BER), репарацию эксцизией нуклеотидов (NER), репарацию прямых повреждений (DR), гомологичную зависимую рекомбинацию (HDR), негомологичное соединение концов (NHEJ), анемию Фанкони. путь (FA) и трансфузионный синтез ДНК (TLS).Дефекты в путях DDR приводят к накоплению геномных аберраций и повышенному TMB (17–19), что способствует развитию опухоли (20). Многие исследования показали, что мутации в генах пути DDR связаны с ответами ICI (20, 21). Пациенты с геномными изменениями DDR обычно имеют лучший клинический эффект после терапии ICI (19, 21).

Алгоритм дисфункции и исключения опухолевого иммунитета (TIDE) представляет собой вычислительный метод, использующий профили экспрессии генов для прогнозирования ответа на ИКИ, особенно успешный при НМРЛ и меланоме (22).TIDE использует определенный набор маркерных генов для оценки дисфункции инфильтрирующих опухоль цитотоксических Т-лимфоцитов и исключения ЦТЛ из-за иммуносупрессивного фактора для прогнозирования реакции пациентов на ИКИ. Пациенты с более низкими показателями TIDE имеют меньшую вероятность ускользания от противоопухолевого иммунного ответа, поэтому у них выше частота ответа на лечение ИКИ (22). Оценка TIDE продемонстрировала более высокую точность, чем уровень экспрессии PD-L1 и TMB, в прогнозировании общей выживаемости пациентов, получавших ICI (20, 23, 24). В некоторых исследованиях также сообщается о его полезности для прогнозирования или оценки эффективности ИКИ (24–28).

Мы идентифицировали семь значимых генов (например, DUT, MGMT, POLH, RAD1, RAD17, TYMS и YWHAG), тесно связанных с прогнозом путей DDR, с помощью регрессионного анализа Кокса.

Пациенты с более низкой экспрессией DUT, TYMS и YWHAG, но более высокой экспрессией MGMT, POLH, RAD1 и RAD17 имели лучший прогноз. На основе выражений и весовых коэффициентов, рассчитанных с помощью регрессии Кокса для этих генов, мы разработали классификатор GDPLichi (гены DDR для прогнозирования ингибиторов иммунных контрольных точек LUAD) в качестве сигнатуры для прогнозирования ответа ICI.Пациенты с LUAD были разделены на группы низкого и высокого риска на основе порогового значения шкалы GDPLichi. Многие признаки, в том числе экспрессия PDCD1, CTLA4, PD-L1, TMB и неоантиген, продемонстрировали сильные способности к различению в анализе выживаемости этих двух подгрупп. В частности, подгруппа высокого риска имела худший прогноз, но, по-видимому, более эффективна в отношении лечения ИКИ.

Материалы и метод

Источник данных

Чтобы предсказать реакцию LUAD ICI, мы разработали многоэтапный подход под названием GDPLichi, описанный ниже (рисунок 1 и дополнительный рисунок S1).Экспрессия генов транскриптома, геномные данные и данные клинического фенотипа 526 образцов TCGA-LUAD были загружены с веб-сайта xenabrowser (https://xenabrowser.net/datapages/). Необработанные данные подсчета транскриптома TCGA RNA-Seq, включая 526 образцов LUAD, были дополнительно перенесены в транскрипт на тысячу пар оснований (TPM). Три проверочные группы необработанных данных, включая 438 образцов LUAD из 3 когорт [GSE31210 (29), GSE30219 (30) и GSE50081 (31)), были загружены из репозитория Gene Expression Omnibus (GEO).Затем необработанные данные были преобразованы в данные экспрессии с использованием пакета «Oligo» в программном обеспечении R. Для генов с несколькими зондами уровни их экспрессии рассчитывали как максимальный уровень экспрессии этих зондов. Наконец, все данные экспрессии были нормализованы и преобразованы в Z-показатели.

Рисунок 1 Общий рабочий процесс GDPLichi. (A) GDPLichi был сконструирован с использованием генов, связанных с повреждением ДНК, и разделил пациентов с LUAD на две подгруппы (низкий и высокий риск). (B) GDPLichi можно использовать для анализа выживаемости, GSEA, иммунной микросреды, TMB, неоантигена, генов иммунных контрольных точек (PD-L1, PD-1, CTLA4) и геномных мутаций между подгруппами низкого и высокого риска. . (C) Алгоритм TIDE был использован для прогнозирования чувствительности к ингибиторам иммунных контрольных точек (ICI) между группами низкого и высокого риска в четырех когортах.

GDPLichi Score

Сначала была использована одномерная регрессионная модель Кокса для оценки ассоциации 276 генов, связанных с репарацией повреждений ДНК (дополнительный файл 1), с общей выживаемостью в когорте TCGA LUAD. Значение P использовалось для идентификации ключевых генов, а гены со значением P <0,05 считались прогностическими генами (дополнительный файл 2).Затем 63 прогностических гена были выбраны для многомерной регрессии Кокса, а гены с P-значением <0,05 считались генами риска (дополнительный файл 3). Наконец, с помощью многомерной регрессии Кокса были получены семь генов риска, которые были объединены для построения классификатора GDPLichi. Путем объединения значений экспрессии генов риска и взвешивания с помощью многомерных коэффициентов регрессии Кокса оценка GDPLichi для каждого пациента была рассчитана следующим образом: значение экспрессии гена i, а β i представляет собой коэффициент регрессии гена i в многомерном регрессионном анализе Кокса.Используя средний балл GDPLichi в качестве порогового значения, пациентов с TCGA и GEO LUAD можно было разделить на группы низкого и высокого риска.

Анализ обогащения набора генов, анализ выживаемости, анализ основных компонентов, анализ микроокружения опухоли и TIDE

Язык R 4.0 применялся в этом исследовании для статистического анализа. GSEA использовался для изучения обогащения путей между группами низкого и высокого риска с использованием R-пакета «clusterProfiler» (32) в базе данных путей Reactome (33) с параметрами по умолчанию.Кратность изменения экспрессии генов между двумя группами использовали для ранжирования генов. Абсолютные значения нормализованной оценки обогащения (NES)> 1 и P-значение ≤0,05 использовались для скрининга значительно обогащенных путей. Пакет «survivalROC» использовался для построения ROC-кривой выживания. Пороговое время выживания было установлено на 36 месяцев. «Лесной участок» использовался в пакете «forestmodel», а параметры «factor_separate_line» были установлены как ИСТИНА. Анализ выживаемости двух групп проводился R-пакетом «survminer».PCA использовали R-пакеты «FactoMineR» и «factoextra» со значениями экспрессии всех генов в качестве входных данных. Мы использовали пакет «xCell» (34) для оценки относительных подмножеств иммунных клеток. Оценка TIDE была рассчитана с помощью алгоритма TIDE (22) с веб-сайта (http://tide.dfci.harvard.edu). Все параметры пакета R можно найти в исходном коде анализа в main_code.R (дополнительный файл 6).

Сбор образцов пациентов

Из когорты TCGA LUAD, загруженной с веб-сайта xenabrowser, были собраны образцы с выживаемостью и геномные данные.В наборах данных GSE31210, GSE50081 и GSE30219 образцы плоскоклеточной карциномы легкого можно было исключить, и были собраны данные об аденокарциноме легкого с выживаемостью.

Результат

Построение GDPLichi

Для оценки ассоциации 276 генов репарации повреждений ДНК с общей выживаемостью в когорте TCGA LUAD использовали одномерную регрессионную модель Кокса. Было отсеяно 63 прогностических гена с начальной значимостью (P <0,05). Используя эти 63 прогностических гена в качестве исходных данных для многомерной регрессии Кокса, семь генов риска (DUT, MGMT, POLH, RAD1, RAD17, TYMS и YWHAG) были отсеяны (рис. 2A), а анализ Каплана-Мейера дополнительно подтвердил прогностическую ценность отдельные гены (дополнительная фигура S2).Многофакторный регрессионный анализ Кокса семи вышеуказанных генов риска показал высокую точность прогнозирования выживаемости пациентов с LUAD (рис. 2B). Путем объединения значений экспрессии семи генов риска и взвешивания коэффициентов регрессии ЦОГ была рассчитана оценка GDPLichi для каждого пациента (описано в 2.2). Для дальнейшего облегчения применения GDPLichi пациенты были разделены на группы низкого и высокого риска в соответствии со средним значением оценки GDPLichi. PCA показал, что пациенты могут быть четко сгруппированы в соответствии с выбранными сигнатурами (семь генов риска) в когорте TCGA LUAD (рис. 2C) и трех когортах проверки GEO (дополнительный рисунок S3A).Кроме того, корреляционный тест Спирмена показал, что GDPLichi значительно коррелирует с выбранными генами в когорте TCGA LUAD (рис. 2D) и трех когортах проверки GEO (рис. S3B).

Рисунок 2. Сигнатура DDR точно предсказывает прогноз для пациентов с LUAD. (A) Одномерный и многомерный регрессионный анализ Кокса выявил семь генов риска. Количество баллов представляет собой оценку отношения между экспрессией каждого выбранного гена и прогнозируемой выживаемостью, рассчитанной с помощью регрессии Кокса.Высокий и низкий представляют собой самый высокий и самый низкий уровни экспрессии гена соответственно. Общие баллы представляли собой сумму индивидуальных баллов семи выбранных генов. На основании суммы баллов рассчитывали 1-летнюю и 3-летнюю прогнозируемую общую выживаемость каждого пациента с ЛУАД. Чем выше число, тем ниже прогнозируемая выживаемость. (B) Многофакторный регрессионный анализ Кокса семи генов риска в прогнозировании выживаемости пациентов с LUAD. (C) PCA на основе профиля экспрессии семи генов риска из разных групп риска. (D) Корреляция между GDPLichi и семью генами риска в когорте TCGA LUAD.

Идентификация прогностически значимых подгрупп ЛУАД в соответствии с GDPLichi

пациентов с ЛУАД были классифицированы в группы низкого или высокого риска на основании средней оценки GDPLichi, описанной выше. Общий анализ выживаемости для этих двух подгрупп показал значительную разницу в когорте TCGA (рисунок 3A, P<0,0001) и трех когортах проверки GEO (дополнительный рисунок S4A).

Рисунок 3. Оценка GDPLichi может использоваться в качестве прогностического индекса для пациентов с LUAD. (A) Графики Каплана-Мейера вероятности выживания для подгрупп низкого и высокого риска когорты TCGA, соответственно. (B) Кривые ROC для эффективности оценки GDPLichi, а также семи генов риска классификатора в TCGA при прогнозировании прогноза. (C) Представление лесного массива многомерной модели Кокса, изображающей связь между общей выживаемостью и подгруппами LUAD с другими клиническими факторами, рассматриваемыми в когорте TCGA.

Отношение рисков двух подгрупп в когорте TCGA составляет 1,912 (GSE30219: 2,99, GSE31210: 3,79, GSE50081: 2,43). 95% доверительный интервал двух подгрупп когорты TCGA составляет 1,421–2,573 (GSE30219: 1,585–5,641, GSE31210: 1,72–8,351, GSE50081: 1,356–4,356). Разница оставалась статистически значимой после поправки на возраст, пол, стадию и статус курения в когорте TCGA (рис. 3C) и трех когортах проверки GEO (дополнительный рисунок S4C). Чтобы проверить практичность классификатора GDPLichi, мы применили анализ ROC (рабочая характеристика приемника) к когорте TCGA и обнаружили, что оценка GDPLichi может функционировать как лучший прогностический индекс, чем любой ген риска в отдельности (рис. 3B).Этот результат также был подтвержден в трех когортах GEO (дополнительный рисунок S4B). Следовательно, GDPLichi может быть хорошей моделью для предсказания прогноза пациентов с LUAD.

GSEA исследовал путь обогащения между группами низкого и высокого риска

Для дальнейшего изучения различий биологических механизмов между группами низкого и высокого риска, разделенными GDPLichi, мы провели GSEA в когорте TCGA LUAD. Выяснилось, что пути, связанные с пролиферацией клеток, такие как клеточный ответ на гипоксию, передача сигналов MAPK и неканоническая передача сигналов NF-κB, были значительно обогащены в группе высокого риска (рис. 4, B).Между тем, пути клеточного цикла также были значительно обогащены в группе высокого риска (рис. 4B, D). Результаты также показали, что иммунные пути, такие как процессинг антигена, перекрестная презентация, передача сигналов интерлейкина-10 и презентация антигена MHC класса II, были значительно обогащены (рис. 4C). При изучении экспрессии генов HLA было обнаружено, что экспрессия генов MHC II в группе низкого риска была значительно выше, чем в группе высокого риска (рис. 4E). Гены MHC II экспрессируются только в антигенпрезентирующих клетках.Это может указывать на более высокий уровень инфильтрирующих опухоль лимфоцитов (TIL) в группе низкого риска и, в конечном итоге, на худший прогноз.

Рисунок 4 Обогащены пути, связанные с пролиферацией и клеточным циклом, но снижены пути, связанные с иммунитетом, в группе высокого риска по сравнению с группой низкого риска, классифицированной GDPLichi. Графики GSEA путей, связанных с пролиферацией (A) , клеточного цикла, (B) , и путей, связанных с иммунной системой (C) . Все транскрипты ранжированы по кратности изменения между подгруппами низкого и высокого риска в когорте TCGA-LUAD. (D, E) Разница в экспрессии генов, связанных с клеточным циклом, клеточным ответом на гипоксию и презентацией антигена, между подгруппами низкого и высокого риска. *Р < 0,05; **Р < 0,01; ***Р < 0,001; ****Р < 0,0001; нс, никакой существенной разницы.

Разница в иммунной микросреде опухоли между группами низкого и высокого риска

Алгоритм «xCell» был использован для оценки иммунных клеток в тканях злокачественной опухоли между двумя подгруппами с использованием данных секвенирования РНК.Наши результаты показали, что иммунные показатели, В-клетки, гемопоэтические стволовые клетки (ГСК), миелоидные дендритные клетки (МДК), CD8 + Т-клетки и CD8 + Т-клетки центральной памяти были значительно выше в группах низкого риска по сравнению с к группам высокого риска, что предполагает более высокий TIL в группе низкого риска (рис. 5A–F). Т-клетки CD8 + , также называемые цитотоксическими Т-клетками, являются одними из основных клеток-киллеров опухолей, а исключение клеток CD8 + тесно связано с ускользанием опухоли от иммунитета.Поэтому мы исследовали экспрессию нескольких генов иммуносупрессии, таких как TIM-3 (HAVCR2), IDO1, LAG3, PD-L2 (PDCD1LG2), TIGIT, CD276, CD160, VEGFA, VEGFB, SLAMF7, KIR2DL3 и IL1B, между низкими — и группы высокого риска. Как показано на рисунке 5G, в группе высокого риска экспрессия генов иммуносупрессии была выше, чем в группе низкого риска, что может объяснять более высокую чувствительность к ИКИ в подгруппе высокого риска пациентов с LUAD.

Рисунок 5 В группе высокого риска LUAD наблюдается относительно более низкая инфильтрация B, HSC, MDC, CD8 + T и Т-клеток памяти, а также более низкие иммунные показатели, чем в группе низкого риска, но более высокая экспрессия гены иммуносупрессии. (A–F) Сравнение инфильтрирующих иммунных клеток (xCell) между группами низкого и высокого риска с использованием алгоритма xCell. (G) Статистический анализ экспрессии генов иммуносупрессии между группами низкого и высокого риска. *Р < 0,05; **Р < 0,01; ***Р < 0,001; ****Р < 0,0001; нс, никакой существенной разницы.

Разница в экспрессии TMB, неоантигена и ICIs-мишеней между подгруппами низкого и высокого риска связанные маркеры, такие как нагрузка опухолевых мутаций (TMB), неоантиген и экспрессия PDCD1 (PD-1), CD274 (PD-L1) и CTLA4.Степень ТМБ и неоантигена в группе высокого риска была значительно выше по сравнению с группой низкого риска в когорте TCGA (рисунки 6A, B). Значительно более высокая экспрессия PD-L1, PDCD1 и CTLA4 также наблюдалась в группе высокого риска по сравнению с группой низкого риска в группе TCGA (рис. 6C), а также в трех когортах проверки GEO (дополнительные рисунки). S5A–С). Эти результаты показали, что группа высокого риска может быть более чувствительна к иммунотерапии. Также было высказано предположение, что модель GDPLichi может помочь предсказать реакцию пациентов с LUAD на ICI.

Рисунок 6 Группа высокого риска демонстрирует более высокий уровень экспрессии TMB и неоантигена, а также экспрессии PD-L1, PDCD1 и CTLA4, чем группа низкого риска. (A, B) Блочная диаграмма TMB и неоантигена между группами низкого и высокого риска когорты TCGA. (C) Статистический анализ экспрессии PD-L1, PDCD1, CTLA4 между группами низкого и высокого риска в когорте TCGA. *Р < 0,05; ***Р < 0,001; ****Р < 0,0001.

Паттерн мутаций генов между группами низкого и высокого риска, классифицированный моделью GDPLichi

Мы идентифицировали 12 кандидатов из 25 наиболее часто мутируемых генов в когорте TCGA пациентов с LUAD, которые демонстрировали значительную разницу между низким и высоким -группа риска, классифицированная GDPLichi (рис. 7).В недавних исследованиях сообщалось, что мутации в генах TTN и MUC16 указывают на высокий ТМБ (35, 36) и могут быть использованы для прогнозирования эффективности иммунотерапии (37). Статус мутации TTN может независимо предсказать прогноз иммунотерапии у пациентов с аденокарциномой легкого после ИКИ (38). Мутация MUC16 была связана с более высокими показателями ответа, связанными с ответом на ICI и общей выживаемостью (39). TP53 является хорошо известным геном-супрессором опухоли, мутация которого встречается более чем в 50% всех злокачественных новообразований. Мутация TP53 обычно связана с плохим прогнозом.В некоторых исследованиях также сообщалось, что потеря CSMD3 приводит к увеличению пролиферации эпителиальных клеток дыхательных путей в LUAD (40). Пациенты с карциномой яичников с мутацией CSMD3 имели устойчивый ответ на анти-PD1 без предшествующей химиотерапии (41). Соматические мутации в гене ZFHX4 связаны с плохой общей выживаемостью у пациентов с раком легких в Китае (42). Мутация RYR2 является важным биомаркером, связанным с высоким уровнем ТМБ при ЛУАД (43). Пациенты с аденокарциномой легкого с мутацией ADAMTS12 имеют худший прогноз (44).В совокупности эти результаты свидетельствуют о том, что группа высокого риска может быть более чувствительна к ICI, а модель GDPLichi может прогнозировать реакцию на ICI.

Рисунок 7 Мутационный ландшафт генов со значительной разницей между подгруппами низкого и высокого риска в когорте TCGA LUAD. *Р < 0,05; **Р < 0,01.

Прогнозирование ответа на ИКИ между группами низкого и высокого риска у пациентов с ЗНБН, классифицированных по модели GDPLichi

Было доказано, что алгоритм TIDE помогает с высокой точностью прогнозировать ответ на ИЦИ у пациентов с ЗНБН (22).Поэтому мы рассчитали баллы TIDE как для групп низкого, так и для высокого риска когорты TCGA LUAD в соответствии с классификацией модели GDPLichi. Результаты показали, что показатель TIDE в группе высокого риска был значительно ниже, чем в группе низкого риска (Рисунок 8A). Аналогичные результаты наблюдались в трех других внешних наборах данных GEO (рис. 8B–D). Эти результаты свидетельствуют о том, что группа высокого риска имеет меньшую вероятность ускользания от противоопухолевого иммунного ответа и более высокий уровень ответа на лечение ИКИ.

Рисунок 8 Показатель TIDE был значительно ниже в группе высокого риска по сравнению с группой низкого риска, классифицированной по модели GDPLichi. (A–D) Статистический анализ оценок TIDE между группами низкого и высокого риска, разделенных на модель GDPLichi в когорте TCGA LUAD и трех других наборах данных GEO внешней проверки. ****Р < 0,0001.

Обсуждение

Рак легкого занимает второе место по заболеваемости и первое место по смертности среди злокачественных новообразований во всем мире (1). В последнее время иммунотерапия стала важным новым терапевтическим подходом к лечению нескольких типов рака с многообещающими результатами. Это сильно изменило ландшафт лечения рака.Многие исследования показали, что мутации в генах пути DDR связаны с прогнозом у пациентов с LUAD (20, 21), однако об использовании профиля экспрессии гена DDR в качестве молекулярной сигнатуры для прогнозирования ответа на ICI у пациентов с LUAD еще не сообщалось. . В этом исследовании мы построили модель GDPLichi на основе семи генов DDR (DUT, MGMT, POLH, RAD1, RAD17, TYMS и YWHAG), чтобы разделить LUAD на две отдельные подгруппы: группы низкого и высокого риска. Тимидилатсинтаза (TYMS) является важной мишенью для химиотерапии рака (45).Гамма-активирующий белок тирозин-3-монооксигеназы/триптофан-5-монооксигеназы (YWHAG) также известен как 14-3-3γ. В недавнем исследовании сообщалось, что нокдаун YWHAG подавляет эпителиально-мезенхимальный переход (ЭМП) и снижает метастатический потенциал НМРЛ человека (46). О-6-метилгуанин-ДНК-метилтрансфераза (МГМТ) катализирует перенос метильных групп от О(6)-алкилгуанина и других метилированных фрагментов ДНК к ее молекуле. Низкая экспрессия белка MGMT была обнаружена в бронхиальном эпителии пациентов с раком легкого по сравнению со здоровым контролем, что позволяет предположить наличие отрицательной корреляции между экспрессией MGMT и риском рака легкого (47).ДНК-полимераза эта (POLH) представляет собой ДНК-полимеразу, принадлежащую к подмножеству белков-супрессоров опухолей, необходимых для поддержания целостности генома (48). RAD1 кодирует компонент гетеротримерного комплекса контрольных точек клеточного цикла, известный как комплекс 9-1-1, который активируется, чтобы остановить развитие клеточного цикла в ответ на повреждение ДНК или неполную репликацию ДНК. RAD17 представляет собой ген контрольной точки клеточного цикла, необходимый для остановки клеточного цикла и восстановления повреждений ДНК в ответ на повреждение ДНК. Этот белок рекрутирует белковый комплекс контрольной точки RAD1-RAD9-HUS1 на хроматин после повреждения ДНК и инициирует репарацию ДНК.

Анализ обогащения набора генов (GSEA) — это вычислительный метод, который определяет, демонстрирует ли априорно определенный набор генов статистически значимые, согласующиеся различия между двумя биологическими состояниями. GSEA показал, что клеточный ответ на гипоксию, передача сигналов MAPK, неканоническая передача сигналов NF-kB и пути клеточного цикла, связанные с пролиферацией клеток, были значительно обогащены в группе высокого риска, что может объяснить более высокую злокачественность и худший прогноз у пациентов с LUAD в группе высокого риска. группа высокого риска.Кислородная депривация (гипоксия) является особенностью солидных опухолей, которая способствует геномной нестабильности, повышенной агрессивности и метастазированию и является важным фактором резистентности к лечению и плохой выживаемости (49). Пути MAPK сходятся в амплификации ключевых молекул, которые поддерживают процессы пролиферации, роста и выживания клеток (50, 51). Неканоническая передача сигналов NF-κB содержит NIK, фосфорилирует IKK/ и помогает IKK/ фосфорилировать p100. Мутации в различных вышестоящих регуляторах (TRAF2, TRAF3, cIAP1&2, CD40) приводят к повышению стабильности NIK и последующей активации неканонического пути NF-kB, и этот механизм активации, по-видимому, важен для различных типов рака, включая DLBC и рак легких. 52).Клеточный цикл человека — это строго регулируемый процесс с контрольными точками для обеспечения целостности генома. Недавние исследования показали, что ингибиторы CDK4 и CDK6 могут способствовать активации Т-клеток (53) и обратному исключению Т-клеток, что приводит к лучшему ответу на ICI (54). В совокупности это говорит о том, что опухолевые клетки в группе высокого риска размножались быстрее, что приводило к увеличению злокачественности.

Кроме того, в группе высокого риска было обнаружено снижение В-клеток, CD8 + Т-клеток, CD8 + Т-клеток центральной памяти, HSC, MDC и иммунных показателей.Зависимое от CD8 T-клеток уничтожение раковых клеток может продуцировать интерферон-гамма (IFN-γ) и затем активировать противоопухолевый иммунитет (55). Миелоидные дендритные клетки (MDC) имеют решающее значение для активации антиген-специфических CD8 T-клеток. В недавнем исследовании сообщалось, что противоопухолевые эффекты ДК могут быть снижены за счет низкого количества ДК, низкой эффективности антигенной презентации инфильтрирующих опухоль ДК и слабой способности ДК мигрировать в опухоль (56). Во многих исследованиях сообщалось, что инфильтрация В-клеток была связана с благоприятным прогнозом при НМРЛ (57–60).Гемопоэтические стволовые клетки (ГСК) представляют собой очень небольшую группу исходных клеток, которые могут самообновляться и генерировать различные клетки крови и иммунные клетки. Опухолевые иммунные инфильтрирующие клетки мигрируют из крови в опухолевые ткани и играют важную роль в иммунной регуляции. Многие исследования показали, что иммунные инфильтрирующие клетки опухоли тесно связаны с эффективностью ИКИ и прогнозом (61, 62).

Интересно, что мы заметили повышенную экспрессию TMB, неоантигена, молекул иммунных контрольных точек и генов иммуносупрессии в группе высокого риска.При этом экспрессия генов MHC II, которые экспрессируются на антигенпрезентирующих клетках только в группе низкого риска, была значительно ниже, чем в группе высокого риска. Было широко изучено, что более высокие молекулы TMB, неоантигена и иммунных контрольных точек являются индикаторами, участвующими в лучшем ответе на лечение ICI (8, 11, 12). Поэтому предполагается, что группа высокого риска может быть более чувствительна к иммунотерапии по сравнению с группой низкого риска, классифицированной моделью GDPLichi.

Далее мы изучили геномные мутации как в группах низкого, так и в высоком риске и выявили 12 кандидатов из первых 25 наиболее мутированных генов, частота мутаций которых имеет значительную разницу между группами низкого и высокого риска, классифицированными по модели GDPLichi.Большинство этих генов связаны с ТМБ (35, 36), что можно использовать для прогнозирования эффективности иммунотерапии.

Алгоритм TIDE представляет собой вычислительный метод, использующий профиль экспрессии генов, связанных с иммунной системой, для прогнозирования ответа ICI. Он особенно эффективен при НМРЛ и меланоме (22) и продемонстрировал более высокую точность, чем уровень экспрессии PD-L1 или только ТМБ, в прогнозировании общей выживаемости пациентов, получавших ИКИ (13, 19, 20). Дальнейший анализ показал, что баллы TIDE в группе высокого риска были значительно ниже, чем в группе низкого риска, что позволяет предположить, что пациент из группы высокого риска более чувствителен к ответу на ICI.Этот вывод был подтвержден в других внешних наборах данных (GSE31210, GSE50081, GSE30219).

В заключение, мы сначала идентифицировали две прогностически и клинически значимые подгруппы LUAD, используя модель GDPLichi, которая была построена из семи генов риска DDR. Пациенты из группы высокого риска показали более низкие баллы TIDE и, следовательно, более чувствительны к ИКИ. Ограничение этого исследования заключалось в том, что оно было ретроспективным, и поэтому результаты должны быть дополнительно подтверждены проспективными исследованиями.

Заявление о доступности данных

Наборы данных, представленные в этом исследовании, можно найти в онлайн-репозиториях. Названия репозитория/репозиториев и инвентарные номера можно найти в статье/дополнительных материалах.

Заявление об этике

Письменное информированное согласие было получено от лица (лиц) на публикацию любых потенциально идентифицируемых изображений или данных, включенных в эту статью.

Вклад авторов

BH, YHL и YLi разработали исследование.YLe и SD собрали данные и провели анализ. FY, TG, XX, YZ, LC, CFQ, NL, XZ, CL, YK, KH и NW помогли проанализировать данные. YLe и SD написали статью. BH, TG и XZ пересмотрели документ. Все авторы прочитали и одобрили окончательный вариант рукописи.

Финансирование

Это исследование было поддержано Национальным фондом естественных наук Китая (номер гранта 81971470 и 32170913) и Фондом Шэньчжэньской комиссии по науке и технологиям (номер программы JCYJ201143803732 и JCYJ20210324120602008) для BH и Китайского фонда постдокторской науки (номер 262M 6)200M Postdoctoral Science. в НЛ.

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Примечания издателя

Все утверждения, изложенные в этой статье, принадлежат исключительно авторам и не обязательно представляют претензии их дочерних организаций, издателя, редакторов и рецензентов. Любой продукт, который может быть оценен в этой статье, или претензии, которые могут быть сделаны его производителем, не гарантируются и не поддерживаются издателем.

Благодарности

Мы благодарны д-ру ШиЦян Чжан за совет по организации результатов.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fonc.2021.733533/full#supplementary-material

Дополнительный рисунок S1 | Подробная блок-схема этого исследования.

Дополнительный рисунок S2 | (A–G) Анализ Каплана-Мейера генов, включенных в конструкцию GDPLichi (DUT, MGMT, POLH, RAD1, RAD17, TYMS и YWHAG). (H) Пример расчета прогнозируемой выживаемости, связанной с .

Дополнительный рисунок S3 | (A) PCA на основе профиля экспрессии семи генов риска в соответствии с различными группами риска и (B) корреляции между GDPLichi и семью генами риска в трех когортах проверки GEO.

Дополнительный рисунок S4 | (A) Графики Каплана-Мейера вероятности выживания для подгрупп низкого и высокого риска, (B) ROC-кривые оценки GDPLichi и семи генов риска классификатора, (C) Представление лесного участка многофакторной модели Кокса показала связь между общей выживаемостью и подгруппами LUAD с другими клиническими факторами, рассмотренными в трех когортах проверки GEO.

Дополнительный рисунок S5 | (A–C) Статистический анализ экспрессии PD-L1, PDCD1, CTLA4 между группами низкого и высокого риска в трех когортах проверки GEO

Дополнительный рисунок S6 | (A) Кривые ROC для эффективности оценки GDPLichi, TMB, экспрессии PD-L1 и неоантигена при прогнозировании прогноза. (B–E) Корреляция между показателем TIDE и показателем GDPLichi, TMB, экспрессией PD-L1 и неоантигеном соответственно. (F) ROC-кривые эффективности исходной оценки семи генов и комбинации трех генов (DUT, TYMS и YWHAG) при прогнозировании прогноза.

Дополнительный файл 1 | Список генов, связанных с DDR.

Дополнительный файл 2 | Результат одномерной регрессии Кокса генов, связанных с DDR.

Дополнительный файл 3 | Результат многомерной регрессии Кокса генов, связанных с DDR.

Дополнительный файл 4 | Ссылка для скачивания исходных данных Jianguoyun.

Дополнительный файл 5 | Все важные пути GSEA.

Дополнительный файл 6 | main_code.R (код исходного анализа R).

Ссылки

1. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Глобальная статистика рака 2020: оценки GLOBOCAN заболеваемости и смертности во всем мире для 36 видов рака в 185 странах. CA Cancer J Clin (2021) 71:209–49. doi: 10.3322/caac.21660

PubMed Abstract | Полный текст перекрестной ссылки | Академия Google

3.Рек М., Родригес-Абреу Д., Робинсон А.Г., Хуи Р., Чошзи Т., Фулоп А. и соавт. Пембролизумаб в сравнении с химиотерапией при PD-L1-положительном немелкоклеточном раке легкого. N Engl J Med (2016) 375:1823–33. doi: 10.1056/NEJMoa1606774

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

4. Herbst RS, Baas P, Kim DW, Felip E, Perez-Gracia JL, Han JY, et al. Пембролизумаб в сравнении с доцетакселом при ранее леченном PD-L1-положительном прогрессирующем немелкоклеточном раке легкого (KEYNOTE-010): рандомизированное контролируемое исследование. Lancet Lond Engl (2016) 387:1540–50. doi: 10.1016/S0140-6736(15)01281-7

CrossRef Полный текст | Google Scholar

6. Акинли А., Расул З. Ингибиторы иммунных контрольных точек PD-L1 как средства для лечения рака. J Hematol Oncol J Hematol Oncol (2019) 12:92. doi: 10.1186/s13045-019-0779-5

CrossRef Полный текст | Google Scholar

7. Niu Y, Lin A, Luo P, Zhu W, Wei T, Tang R, et al. Прогноз пациентов с аденокарциномой легких с мутациями NTRK3 к ингибиторам иммунных контрольных точек. Front Pharmacol (2020) 11:1213. doi: 10.3389/fphar.2020.01213

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

8. Taube JM, Klein A, Brahmer JR, Xu H, Pan X, Kim JH, et al. Ассоциация PD-1, лигандов PD-1 и других характеристик иммунного микроокружения опухоли с ответом на анти-PD-1 терапию. Clin Cancer Res (2014) 20:5064–74. doi: 10.1158/1078-0432.CCR-13-3271

PubMed Abstract | Полный текст перекрестной ссылки | Академия Google

9.Дорошоу Д.Б., Бхалла С., Бизли М.Б., Шолл Л.М., Керр К.М., Гнятик С. и др. PD-L1 как биомаркер ответа на ингибиторы иммунных контрольных точек. Nat Rev Clin Oncol (2021) 18:345–62. doi: 10.1038/s41571-021-00473-5

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

10. Mehnert JM, Monjazeb AM, Beerthuijzen JMT, Collyar D, Rubinstein L, Harris LN. Проблема разработки ценных иммуноонкологических биомаркеров. Clin Cancer Res (2017) 23:4970–9.doi: 10.1158/1078-0432.CCR-16-3063

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

11. Hollern DP, Xu N, Thennavan A, Glodowski C, Garcia-Recio S, Mott KR, et al. В-клетки и Т-фолликулярные хелперные клетки опосредуют ответ на ингибиторы контрольных точек в моделях рака молочной железы на мышах с высоким бременем мутаций. Cell (2019) 179:1191–206.e21. doi: 10.1016/j.cell.2019.10.028

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

12. Ризви Н.А., Хеллманн М.Д., Снайдер А., Квистборг П., Макаров В., Гавел Дж.Дж. и соавт.Мутационный ландшафт определяет чувствительность к блокаде PD-1 при немелкоклеточном раке легкого. Наука (2015) 348:124–8. doi: 10.1126/science.aaa1348

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

13. Hellmann MD, Ciuleanu TE, Pluzanski A, Lee JS, Otterson GA, Audigier-Valette C, et al. Ниволумаб плюс ипилимумаб при раке легкого с высокой мутационной нагрузкой опухоли. N Engl J Med (2018) 378:2093–104. doi: 10.1056/NEJMoa1801946

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

14.Hellmann MD, Nathanson T, Rizvi H, Creelan BC, Sanchez-Vega F, Ahuja A, et al. Геномные особенности ответа на комбинированную иммунотерапию у больных распространенным немелкоклеточным раком легкого. Раковая клетка (2018) 33:843–52.e4. doi: 10.1016/j.ccell.2018.03.018

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

15. Стриклер Дж. Х., Хэнкс Б. А., Хасрав М. Мутационная нагрузка опухоли как предиктор ответа иммунотерапии: больше всегда лучше? Clin Cancer Res (2021) 27:1236–41.doi: 10.1158/1078-0432.CCR-20-3054

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

16. Булик-Салливан Б., Басби Дж., Палмер К.Д., Дэвис М.Дж., Мерфи Т., Кларк А. и др. Глубокое обучение с использованием наборов данных масс-спектрометрии пептида HLA опухоли улучшает идентификацию неоантигена. Nat Biotechnol (2018) 37, 55–63. doi: 10.1038/nbt.4313

CrossRef Полный текст | Google Scholar

17. Teo MY, Bambury RM, Zabor EC, Jordan E, Al-Ahmadie H, Boyd ME, et al.Реакция на повреждение ДНК и изменения гена репарации связаны с улучшением выживаемости у пациентов с запущенной уротелиальной карциномой, получающих лечение платиной. Clin Cancer Res (2017) 23:3610–8. doi: 10.1158/1078-0432.CCR-16-2520

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

18. Парих А.Р., Хе Ю., Хонг Т.С., Коркоран Р.Б., Кларк Дж.В., Райан Д.П. и др. Анализ изменений гена реакции на повреждение ДНК и мутационного бремени опухоли в 17 486 тубулярных желудочно-кишечных карциномах: значение для терапии. Онколог (2019) 24:1340–7. doi: 10.1634/theoncologist.2019-0034

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

19. Wang Z, Zhao J, Wang G, Zhang F, Zhang Z, Zhang F, et al. Коммутации в путях реакции на повреждение ДНК служат потенциальными биомаркерами для блокады контрольных точек иммунитета. Cancer Res (2018) 78:6486–96. doi: 10.1158/0008-5472.CAN-18-1814

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

20. Knijnenburg TA, Wang L, Zimmermann MT, Chambwe N, Gao GF, Cherniack AD, et al.Геномный и молекулярный ландшафт дефицита репарации повреждений ДНК в атласе генома рака. Cell Rep (2018) 23:239–54.e6. doi: 10.1016/j.celrep.2018.03.076

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

21. Teo MY, Seier K, Ostrovnaya I, Regazzi AM, Kania BE, Moran MM, et al. Изменения в генах ответа на повреждение ДНК и репарации как потенциальный маркер клинической пользы от блокады PD-1/PD-L1 при распространенном уротелиальном раке. J Clin Oncol (2018) 36:1685–94.doi: 10.1200/JCO.2017.75.7740

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

22. Jiang P, Gu S, Pan D, Fu J, Sahu A, Hu X и ​​другие. Признаки дисфункции и исключения Т-клеток предсказывают ответ на иммунотерапию рака. Nat Med (2018) 24:1550–8. doi: 10.1038/s41591-018-0136-1

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

23. Kaderbhaï C, Tharin Z, Ghiringhelli F. Роль молекулярного профилирования в прогнозировании реакции на ингибиторы иммунных контрольных точек при раке легких. Раки (2019) 11(2):201. doi: 10.3390/cancers11020201

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

24. Ван С., Хэ З., Ван С., Ли Х., Лю Х-С. Презентация антигена и иммуногенность опухоли в прогнозировании ответа на иммунотерапию рака. eLife (2019) 8:e49020. doi: 10.7554/eLife.49020

Полный текст CrossRef | Google Scholar

25. Батлер А., Хоффман П., Смиберт П., Папалекси Э., Сатия Р. Интеграция транскриптомных данных отдельных клеток в различных условиях, технологиях и видах. Nat Biotechnol (2018) 36:411–20. doi: 10.1038/nbt.4096

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

26. Bretz AC, Parnitzke U, Kronthaler K, Dreker T, Bartz R, Hermann F, et al. Доматиностат способствует ответу на иммунотерапию, модулируя иммунную микросреду опухоли (ВРЕМЯ). J Immunother Cancer (2019) 7:294. doi: 10.1186/s40425-019-0745-3

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

27. Pallocca M, Angeli D, Palombo F, Sperati F, Milella M, Goeman F, et al.Комбинации ингибиторов иммуно-контрольных точек Прогностические биомаркеры лишь незначительно улучшают их индивидуальную точность. J Transl Med (2019) 17:131. doi: 10.1186/s12967-019-1865-8

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

29. Окаяма Х., Коно Т., Исии Ю., Шимада Ю., Шираиси К., Ивакава Р. и др. Идентификация генов с повышенной активностью в ALK-позитивных и EGFR/KRAS/ALK-негативных аденокарциномах легких. Cancer Res (2012) 72:100–11. doi: 10.1158/0008-5472.CAN-11-1403

Реферат PubMed | Полный текст перекрестной ссылки | Google Scholar

30. Rousseaux S, Debernardi A, Jacquiau B, Vitte AL, Vesin A, Nagy-Mignotte H, et al. Эктопическая активация зародышевых и плацентарных генов идентифицирует агрессивный рак легкого, склонный к метастазированию. Sci Transl Med (2013) 5:186ra66. doi: 10.1126/scitranslmed.3005723

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

31. Der SD, Sykes J, Pintilie M, Zhu CQ, Strumpf D, Liu N, et al.Валидация гистологически независимой прогностической сигнатуры гена для ранней стадии немелкоклеточного рака легкого, включая пациентов со стадией IA. J Thorac Oncol (2014) 9:59–64. doi: 10.1097/JTO.0000000000000042

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

32. Yu G, Wang L-G, Han Y, He Q-Y. Clusterprofiler: пакет R для сравнения биологических тем среди кластеров генов. Omics J Integr Biol (2012) 16:284–7. doi: 10.1089/omi.2011.0118

CrossRef Полный текст | Академия Google

35.Oh JH, Jang SJ, Kim J, Sohn I, Lee JY, Cho EJ и др. Спонтанные мутации в одном гене TTN представляют собой высокую нагрузку мутаций опухоли. NPJ Genomic Med (2020) 5:33. doi: 10.1038/s41525-019-0107-6

CrossRef Полный текст | Google Scholar

36. Li X, Pasche B, Zhang W, Chen K. Связь мутации MUC16 с опухолевой мутационной нагрузкой и исходами у пациентов с раком желудка. JAMA Oncol (2018) 4:1691–8. doi: 10.1001/jamaoncol.2018.2805

PubMed Abstract | Полный текст перекрестной ссылки | Академия Google

37.Yang Y, Zhang J, Chen Y, Xu R, Zhao Q, Guo W и др. Мутация генов MUC4, MUC16 и TTN коррелирует с прогнозом, а также прогнозируемой нагрузкой мутаций опухоли и эффективностью иммунотерапии при раке желудка и панраке. Clin Transl Med (2020) 10:e155. doi: 10.1002/ctm2.155

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

38. Wang Z, Wang C, Lin S, Yu X. Влияние мутаций TTN на иммунную микросреду и эффективность иммунотерапии у пациентов с аденокарциномой легких. Передний Oncol (2021) 11:725292. doi: 10.3389/fonc.2021.725292

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

39. Zhang L, Han X, Shi Y. Связь мутации MUC16 с реакцией на ингибиторы иммунных контрольных точек в солидных опухолях. JAMA Netw Open (2020) 3:e2013201. doi: 10.1001/jamanetworkopen.2020.13201

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

40. Liu P, Morrison C, Wang L, Xiong D, Vedell P, Cui P, et al.Идентификация соматических мутаций в немелкоклеточных карциномах легкого с использованием полноэкзомного секвенирования. Канцерогенез (2012) 33:1270–6. doi: 10.1093/carcin/bgs148

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

41. Terzic J, Seipel A, Dubuisson J, Tille JC, Tsantoulis P, Addeo A, et al. Устойчивый ответ на пембролизумаб без предшествующей химиотерапии при высокозлокачественной серозной карциноме яичников с мутацией CSMD3. Gynecol Oncol Rep (2020) 33:100600.doi: 10.1016/j.gore.2020.100600

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

42. Qing T, Zhu S, Suo C, Zhang L, Zheng Y, Shi L, et al. Соматические мутации в гене ZFHX4 связаны с плохой общей выживаемостью пациентов с плоскоклеточным раком пищевода в Китае. Научный представитель (2017) 7:4951. doi: 10.1038/s41598-017-04221-7

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

43. Wang C, Liang H, Lin C, Li F, Xie G, Qiao S, et al.Молекулярный подтип и прогностическая оценка на основе бремени опухолевых мутаций у пациентов с аденокарциномами легких. Int J Mol Sci (2019) 20. doi: 10.3390/ijms20174251

CrossRef Полный текст | Google Scholar

44. Мохамеди Ю., Фонтанил Т., Кэл С., Кобо Т., Обая А.Дж. ADAMTS-12: функции и задачи комплексной металлопротеазы. Front Mol Biosci (2021) 8:686763. doi: 10.3389/fmolb.2021.686763

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

46.Raungrut P, ​​Wongkotsila A, Champoochana N, Lirdprapamongkol K, Svasti J, Thongsuksai P. Нокдаун 14-3-3γ подавляет эпителиально-мезенхимальный переход и снижает метастатический потенциал клеток немелкоклеточного рака легкого человека. Anticancer Res (2018) 38:3507–14. doi: 10.21873/anticanres.12622

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

48. Барнс Р.П., Цао В.К., Молдован Г.Л., Эккерт К.А. ДНК-полимераза Eta предотвращает остановку клеточного цикла опухоли и гибель клеток во время восстановления после стресса репликации. Cancer Res (2018) 78:6549–60. doi: 10.1158/0008-5472.CAN-17-3931

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

49. Ren W, Mi D, Yang K, Cao N, Tian J, Li Z и другие. Экспрессия индуцируемого гипоксией фактора-1α и его клиническое значение при раке легкого: систематический обзор и метаанализ. Swiss Med Wkly (2013) 143:w13855. doi: 10.4414/smw.2013.13855

PubMed Abstract | Полный текст перекрестной ссылки | Академия Google

50.Плотников А., Флорес К., Майк-Рахлин Г., Зехорай Э., Капри-Пардес Э., Берти Д.А. и др. Ядерная транслокация ERK1/2 как противораковая мишень. Nat Commun (2015) 6:6685. doi: 10.1038/ncomms7685

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

53. Руни М.С., Шукла С.А., Ву С.Дж., Гетц Г., Хакоэн Н. Молекулярные и генетические свойства опухолей, связанные с местной иммунной цитолитической активностью. Cell (2015) 160:48–61. doi: 10.1016/j.cell.2014.12.033

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

54.Джерби-Арнон Л., Шах П., Куоко М.С., Родман С., Су М.Дж., Мелмс Дж.К. и др. Программа раковых клеток способствует исключению Т-клеток и устойчивости к блокаде контрольных точек. Cell (2018) 175:984–97.e24. doi: 10.1016/j.cell.2018.09.006

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

56. Шан Н., Фигини М., Шангуан Дж., Ван Б., Сун С., Пан Л. и др. Иммунотерапия на основе дендритных клеток. Am J Cancer Res (2017) 7: 2091–102.

Реферат PubMed | Академия Google

57.Ван С., Лю С.С., Ли В., Сюй Д., Цюй Х., Чжан Л. и др. В-клетки, проникающие в опухоль: их роль и применение в противоопухолевом иммунитете при раке легкого. Cell Mol Immunol (2019) 16:6–18. doi: 10.1038/s41423-018-0027-x

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

58. Liu X, Xu J, Zhang B, Liu J, Liang C, Meng Q и др. Взаимная регуляция между тканью-хозяином и иммунными клетками при аденокарциноме протоков поджелудочной железы: новые идеи и терапевтические последствия. Мол Рак (2019) 18:184. doi: 10.1186/s12943-019-1117-9

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

59. Gottlin EB, Bentley RC, Campa MJ, Pisetsky DS, Herndon JE 2nd, Patz EF Jr, et al. Ассоциация внутриопухолевых зародышевых центров с немелкоклеточным раком легкого на ранней стадии. J Thorac Oncol (2011) 6:1687–90. doi: 10.1097/JTO.0b013e3182217bec

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

60. Germain C, Gnjatic S, Tamzalit F, Knockaert S, Remark R, Goc J, et al.Наличие В-клеток в третичных лимфоидных структурах связано с защитным иммунитетом у больных раком легкого. Am J Respir Crit Care Med (2014) 189:832–44. doi: 10.1164/rccm.201309-1611OC

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

61. Аль-Шибли К.И., Доннем Т., Аль-Саад С., Перссон М., Бремнес Р.М., Бюзунд Л.Т. Прогностический эффект инфильтрации эпителиальных и стромальных лимфоцитов при немелкоклеточном раке легкого. Clin Cancer Res (2008) 14:5220–7.doi: 10.1158/1078-0432.CCR-08-0133

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

62. Киношита Т., Мурамацу Р., Фудзита Т., Нагумо Х., Сакураи Т., Нодзи С. и др. Прогностическое значение инфильтрирующих опухоль лимфоцитов различается в зависимости от гистологического типа и привычки к курению при полностью резецированном немелкоклеточном раке легкого. Энн Онкол (2016) 27:2117–23. doi: 10.1093/annonc/mdw319

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Роль NBS1 в репарации двухцепочечных разрывов ДНК, стабильности теломер и контроле контрольных точек клеточного цикла

  • Abraham RT .Передача сигналов контрольной точки клеточного цикла через киназы ATM и ATR. Гены Дев 2001; 15 :2177–96.

    КАС Статья Google ученый

  • Голлин С.М. Механизмы, ведущие к хромосомной нестабильности. Semin Cancer Biol 2005; 15 : 33–42.

    КАС пабмед Google ученый

  • Таучи Х., Мацуура С., Кобаяши Дж., и др. .Ген синдрома поломки Неймегена, NBS1, и молекулярные связи с факторами стабильности генома. Онкоген 2002; 21 :8967–80.

    КАС пабмед Google ученый

  • Саар К., Хшановска К.Х., Штумм М., и др. . Ген варианта атаксии-телеангиэктазии, синдрома разрыва Неймегена, картируется в интервале 1 см на хромосоме 8q21. Am J Hum Genet 1997; 60 :605–10.

    КАС пабмед ПабМед Центральный Google ученый

  • Варон Р., Виссинга С., Платцер М., и др. .Нибрин, новый белок репарации двухцепочечных разрывов ДНК, мутирует при синдроме разрыва Неймегена. Сотовый 1998; 93 : 467–76.

    КАС Статья Google ученый

  • Distel L, Neubauer S, Varon R, и др. . Смертельная токсичность после радио- и химиотерапии медуллобластомы у ребенка с нераспознанным синдромом разрыва Неймегена. Med Pediatr Oncol 2003; 41 :44–8.

    ПабМед Google ученый

  • Таучи Х., Мацуура С., Исомура М., и др. . Анализ последовательности участка геномной ДНК размером 800 т.п.н. на хромосоме 8q21, который содержит ген синдрома разрыва Неймегена, NBS1. Геномика 1999; 55 :242–7.

    КАС пабмед Google ученый

  • Дюмон-Джонс В., Фраппарт П.О., Тонг В.М., и др. .Гетерозиготность NBN делает мышей восприимчивыми к образованию опухолей и онкогенезу, индуцированному ионизирующим излучением. Рак Res 2003; 63 :7263–9.

    КАС пабмед Google ученый

  • Таучи Х., Кобаяши Дж., Морисима К., и др. . NBS1 необходим для репарации ДНК путем гомологичной рекомбинации в клетках высших позвоночных. Природа 2002 г.; 420 :93–8.

    КАС пабмед Google ученый

  • Тейлор А.М.Синдромы хромосомной нестабильности. Best Pract Res Clin Haematol 2001; 14 :631–44.

    КАС пабмед Google ученый

  • Weemaes CM, Smeets DF, van der Burgt CJ. Синдром разрыва Неймегена: отчет о проделанной работе. Int J Radiat Biol 1994; 66 :S185–8.

    КАС пабмед Google ученый

  • Вильда М., Демут И., Конкэннон П., и др. .Характер экспрессии гена синдрома поломки Неймегена, NBS1, во время развития мышей. Хум Мол Жене 2000; 9 :1739–44.

    КАС пабмед Google ученый

  • Зайдеманн К., Тиманн М., Хенце Г., и др. . Терапия неходжкинской лимфомы у детей с первичным иммунодефицитом: анализ 19 пациентов из исследований NFM. Med Pediatr Oncol 1999; 33 :536–44.

    КАС пабмед Google ученый

  • Резник И.Б., Кондратенко И., Тогоев О., и др. . Синдром разрыва Неймегена: клинические характеристики и анализ мутаций в восьми неродственных российских семьях. J Pediatr 2002; 140 :355–61.

    Google ученый

  • Бушеми Г., Савио С., Заннини Л., и др. . Зависимость активации CHK2 от NBS1 после повреждения ДНК. Mol Cell Biol 2001; 21 :5214–22.

    КАС пабмед ПабМед Центральный Google ученый

  • Zhang Y, Lim CUK, Williams ES, и др. . Нокдаун NBS1 с помощью малой интерферирующей РНК усиливает мутагенез ионизирующего излучения и ассоциацию теломер в клетках человека. Рак Res 2005; 65 :5544–53.

    КАС пабмед Google ученый

  • Варон Р., Симанова Э., Хшановска К., и др. .Клиническое подтверждение синдрома перелома Неймегена (NBS) и распространенности основной мутации 657del5 в трех славянских популяциях. Eur J Hum Genet 2000; 8 :900–2.

    КАС пабмед Google ученый

  • Кобаяши Дж., Таучи Х., Сакамото С., и др. . NBS1 локализуется в очагах гамма-h3AX посредством взаимодействия с доменом FHA/BRCT. Карр Биол 2002; 12 :1846–51.

    КАС пабмед Google ученый

  • Мацуура С., Кобаяши Дж., Таучи Х., Комацу К. .Синдром разрыва Неймегена и репарация двухцепочечного разрыва ДНК с помощью комплекса NBS1. Adv Biophys 2004; 38 :65–80.

    КАС пабмед Google ученый

  • Десаи-Мехта А., Черосалетти К.М., Конкэннон П. . Различные функциональные домены нибрина опосредуют связывание MRE11, формирование фокуса и локализацию в ядре. Mol Cell Biol 2001; 21 :2184–91.

    КАС пабмед ПабМед Центральный Google ученый

  • Кан Дж., Бронсон Р.Т., Сюй Й.Направленное разрушение NBS1 раскрывает его роль в развитии мышей и репарации ДНК. Embo J 2002; 21 :1447–55.

    КАС пабмед ПабМед Центральный Google ученый

  • Уильямс Б.Р., Мирзоева О.К., Морган В.Ф., и др. . Мышиная модель синдрома разрыва Неймегена. Карр Биол 2002; 12 :648–53.

    КАС пабмед Google ученый

  • Мазер Р.С., Зинкель Р., Петрини Дж.Х.Альтернативный способ трансляции позволяет получить вариант белка NBS1 из общего аллеля синдрома поломки Неймегена. Нат Жене 2001; 27 :417–21.

    КАС пабмед ПабМед Центральный Google ученый

  • Дасика Г.К., Лин С.К., Чжао С., и др. . Контрольные точки клеточного цикла, индуцированные повреждением ДНК, и репарация разрывов цепей ДНК при развитии и онкогенезе. Онкоген 1999; 18 :7883–99.

    КАС Google ученый

  • Ferguson DO, Alt FW . Репарация двухцепочечных разрывов ДНК и хромосомная транслокация: уроки на животных моделях. Онкоген 2001; 20 :5572–9.

    КАС пабмед Google ученый

  • Коллис С.Дж., ДеВиз Т.Л., Джегго П.А., Паркер А.Р. Жизнь и смерть ДНК-ПК. Онкоген 2005; 24 :949–61.

    КАС пабмед Google ученый

  • Полл Т.Т., Геллерт М. . Экзонуклеазная активность MRE11 от 3′ до 5′ облегчает репарацию двухцепочечных разрывов ДНК. Мол Ячейка 1998; 1 :969–79.

    КАС пабмед Google ученый

  • Полл Т.Т., Геллерт М. . NBS1 потенцирует раскручивание ДНК под действием АТФ и эндонуклеазное расщепление комплексом MRE11/RAD50. Гены Дев 1999; 13 :1276–88.

    КАС пабмед ПабМед Центральный Google ученый

  • Д’Амурс Д., Джексон С.П. Комплекс MRE11: на перекрестке репарации ДНК и передачи сигналов контрольных точек. Nat Rev Mol Cell Biol 2002; 3 :317–27.

    КАС пабмед Google ученый

  • Хабер Дж. Э. . Множество интерфейсов MRE11. Сотовый 1998; 95 :583–6.

    КАС Google ученый

  • Бултон С.Дж., Джексон С.П. Компоненты ku-зависимого негомологичного пути соединения концов участвуют в поддержании длины теломер и молчании теломер. Embo J 1998; 17 :1819–28.

    КАС пабмед ПабМед Центральный Google ученый

  • Уэно М., Накадзаки Т., Акамацу Ю., и др. .Молекулярная характеристика гена NBS1 schizosaccharomyces pombe, участвующего в репарации ДНК и поддержании теломер. Mol Cell Biol 2003; 23 :6553–63.

    КАС пабмед ПабМед Центральный Google ученый

  • Clatworthy AE, Valencia-Burton MA, Haber JE, Oettinger MA . Комплекс MRE11-RAD50-XRS2, в дополнение к другим негомологичным факторам соединения концов, необходим для соединения V(D)J у дрожжей. J Biol Chem 2005; 280 :20247–52.

    КАС пабмед Google ученый

  • Охта К., Николя А., Фурусе М., и др. . Мутации в генах MRE11, RAD50, XRS2 и MRE2 изменяют конфигурацию хроматина в местах двухцепочечных разрывов мейотической ДНК в премейотических и мейотических клетках. Proc Natl Acad Sci USA 1998; 95 : 646–51.

    КАС пабмед ПабМед Центральный Google ученый

  • Хуан Дж., Дайнан В.С.Реконструкция реакции соединения двухцепочечных разрывов ДНК млекопитающих выявляет потребность во фракции, содержащей MRE11/RAD50/NBS1. Nucleic Acids Res 2002; 30 :667–74.

    КАС пабмед ПабМед Центральный Google ученый

  • Удаякумар Д., Бладен К.Л., Хадсон Ф.З., Дайнан В.С. Различные пути негомологичного соединения концов, которые по-разному регулируются ДНК-зависимым фосфорилированием, опосредованным протеинкиназой. J Biol Chem 2003; 278 :41631–5.

    КАС пабмед Google ученый

  • Харфст Э., Купер С., Нойбауэр С., и др. . Нормальная рекомбинация V(D)J в клетках пациентов с синдромом разрыва Неймегена. Молекулярная иммунология 2000; 37 :915–29.

    КАС пабмед Google ученый

  • Шайло Ю.ATM и родственные протеинкиназы: защита целостности генома. Nat Rev Рак 2003; 3 :155–68.

    КАС пабмед Google ученый

  • Шайло Ю. Банкомат: Готов, установлен, вперед. Клеточный цикл 2003; 2 :116–7.

    КАС пабмед Google ученый

  • Вейцман Н., Шайло Ю., Барзилай А. . О вкладе белка ATM в поддержание клеточного гомеостаза свидетельствует непрерывная активация пути AP-1 в мозге с дефицитом ATM. J Biol Chem 2003; 278 :6741–7.

    КАС пабмед Google ученый

  • Авраам RT . Киназы, связанные с PI-3-киназой: «крупные» игроки в стресс-индуцированных сигнальных путях. Ремонт ДНК (Amst) 2004; 3 :883–7.

    КАС Google ученый

  • Баккенист С.Дж., Кастан М.Б. Запуск клеточных стрессовых реакций. Сотовый 2004; 118 : 9–17.

    КАС пабмед Google ученый

  • Goodarzi AA, Block WD, Lees-Miller SP . Роль ATM и ATR в контроле клеточного цикла, вызванного повреждением ДНК. Prog Cell Cycle Res 2003; 5 :393–411.

    ПабМед Google ученый

  • Фальк Дж., Коутс Дж., Джексон С.П. Законсервированные способы рекрутирования ATM, ATR и DNA-PKcs в места повреждения ДНК. Природа 2005 г.; 434 :605–11.

    КАС пабмед Google ученый

  • Узиэль Т., Леренталь Ю., Мойал Л., и др. . Необходимость комплекса MRN для активации АТМ при повреждении ДНК. Embo J 2003; 22 :5612–21.

    КАС пабмед ПабМед Центральный Google ученый

  • Карсон К.Т., Шварц Р.А., Стрэкер Т.Х., и др. .Комплекс MRE11 необходим для активации банкоматов и КПП G2/M. Embo J 2003; 22 :6610–20.

    КАС пабмед ПабМед Центральный Google ученый

  • Ли Дж.Х., Полл Т.Т. Активация ATM двухцепочечными разрывами ДНК нарушает комплекс MRE11-RAD50-NBS1. Наука 2005; 308 :551–4.

    КАС пабмед Google ученый

  • Ли Дж.Х., Полл Т.Т.Прямая активация протеинкиназы ATM комплексом MRE11/RAD50/NBS1. Наука 2004; 304 :93–6.

    КАС пабмед Google ученый

  • Horejsi Z, Falck J, Bakkenist CJ, и др. . Различные функциональные домены NBS1 модулируют время и величину активации ATM после низких доз ионизирующего излучения. Онкоген 2004; 23 :3122–7.

    КАС пабмед Google ученый

  • Stiff T, Reis C, Alderton GK, и др. .NBS1 необходим для ATR-зависимых событий фосфорилирования. Embo J 2005; 24 :199–208.

    КАС пабмед Google ученый

  • Таучи Х., Кобаяси Дж., Моришима К., и др. . Ассоциированный с forkhead домен NBS1 необходим для образования ядерных очагов после облучения, но не важен для активности репарации ДНК комплекса hRAD50/hMRE11/NBS1. J Biol Chem 2001; 276 : 12–5.

    КАС Google ученый

  • Лавин М.Ф., Биррелл Г., Чен П., и др. . Передача сигналов ATM и стабильность генома в ответ на повреждение ДНК. Мутат Рез 2005; 569 : 123–32.

    КАС пабмед Google ученый

  • Лим Д.С., Ким С.Т., Сюй Б., и др. . ATM фосфорилирует p95/NBS1 в пути контрольной точки S-фазы. Природа 2000; 404 :613–7.

    КАС Google ученый

  • Чжао С., Венг Ю.С., Юань С.С., и др. . Функциональная связь между атаксией-телеангиэктазией и продуктами генов синдрома разрыва Неймегена. Природа 2000; 405 :473–7.

    КАС Google ученый

  • Girard PM, Riballo E, Begg AC, и др. . NBS1 способствует ATM-зависимым событиям фосфорилирования, включая те, которые необходимы для ареста G1/S. Онкоген 2002; 21 :4191–9.

    КАС пабмед Google ученый

  • Lee JH, Xu B, Lee CH, и др. . Отличительные функции синдрома разрыва Неймегена при атаксии телеангиэктазии, зависящие от мутаций в ответ на повреждение ДНК. Mol Cancer Res 2003; 1 :674–81.

    КАС пабмед Google ученый

  • Язди П.Т., Ван Ю., Чжао С., и др. .SMC1 является нижестоящим эффектором в ветви ATM/NBS1 контрольной точки S-фазы человека. Гены Дев 2002; 16 :571–82.

    КАС пабмед ПабМед Центральный Google ученый

  • Гейти М., Слопер К., Соренсен С., и др. . Мутированная атаксия-телеангиэктазия (ATM) и NBS1-зависимое фосфорилирование CHK1 по ser-317 в ответ на ионизирующее излучение. J Biol Chem 2003; 278 :14806–11.

    КАС пабмед Google ученый

  • Донг З., Чжун К., Чен П.Л. Белок синдрома разрыва Неймегена необходим для фосфорилирования MRE11 при повреждении ДНК. J Biol Chem 1999; 274 :19513–6.

    КАС Google ученый

  • Унсал-Качмаз К., Санкар А. . Четвертичная структура ATR и влияние ATRIP и репликационного белка а на его ДНК-связывание и киназную активность. Mol Cell Biol 2004; 24 :1292–300.

    КАС пабмед ПабМед Центральный Google ученый

  • Осборн А.Дж., Элледж С.Дж., Цзоу Л. Проверка на развилке: путь реакции на стресс репликации ДНК. Trends Cell Biol 2002; 12 :509–16.

    КАС Google ученый

  • Цзоу Л., Элледж С.Дж. Обнаружение повреждения ДНК посредством распознавания ATRIP комплексов RPA-оцДНК. Наука 2003; 300 :1542–8.

    КАС пабмед ПабМед Центральный Google ученый

  • Готлиб ТМ, Джексон С.П. ДНК-зависимая протеинкиназа: потребность в концах ДНК и ассоциация с антигеном Ku. Сотовый 1993; 72 :131–42.

    КАС Google ученый

  • Двир А., Петерсон С.Р., Кнут М.В., и др. .Аутоантиген Ku является регуляторным компонентом ассоциированной с матрицей протеинкиназы, которая фосфорилирует РНК-полимеразу ii. Proc Natl Acad Sci USA 1992; 89 :11920–4.

    КАС пабмед Google ученый

  • Макихерн М.Дж., Краускопф А., Блэкберн Э.Х. Теломеры и их контроль. Annu Rev Genet 2000; 34 :331–58.

    КАС Google ученый

  • Блэкберн Э.Х.Переключение и передача сигналов на теломерах. Сотовый 2001; 106 :661–73.

    КАС пабмед Google ученый

  • Бай Ю, Мурнан Дж.П. Нестабильность теломер в линии опухолевых клеток человека, экспрессирующих NBS1, с мутациями в сайтах, фосфорилированных atm. Mol Cancer Res 2003; 1 :1058–69.

    КАС пабмед Google ученый

  • Бейли С.М., Гудвин Э.Х.ДНК и теломеры: начало и конец. Cytogenet Genome Res 2004; 104 :109–15.

    КАС пабмед Google ученый

  • Уотсон Д.Д. Происхождение конкатемерной ДНК t7. Nat New Biol 1972; 239 : 197–201.

    КАС пабмед Google ученый

  • Грейдер К.В., Блэкберн Э.Х. Идентификация специфической терминальной трансферазной активности теломер в экстрактах тетрахимены. Сотовый 1985; 43 :405–13.

    КАС Google ученый

  • Ю Г.Л., Брэдли Д.Д., Аттарди Л.Д., Блэкберн Э.Х. In vivo изменение последовательностей теломер и старение, вызванное мутацией РНК тетрагимена теломеразы. Природа 1990; 344 : 126–32.

    КАС Google ученый

  • Беннет С.Б., Льюис А.Л., Болдуин К.К., Резник М.А.Летальность, вызванная одним сайт-специфическим двухцепочечным разрывом в заменимой дрожжевой плазмиде. Proc Natl Acad Sci USA 1993; 90 :5613–7.

    КАС пабмед Google ученый

  • Санделл Л.Л., Закиан В.А. Потеря теломер дрожжей: арест, восстановление и потеря хромосом. Сотовый 1993; 75 :729–39.

    КАС пабмед ПабМед Центральный Google ученый

  • Роткамм К., Лобрич М. .Доказательства отсутствия репарации двухцепочечных разрывов ДНК в клетках человека, подвергшихся воздействию очень низких доз рентгеновского излучения. Proc Natl Acad Sci USA 2003; 100 :5057–62.

    КАС Google ученый

  • Бейли С.М., Бреннеман М.А., Халбрук Дж., и др. . Киназная активность ДНК-ПК необходима для защиты теломер млекопитающих. Ремонт ДНК (Amst) 2004; 3 :225–33.

    КАС Google ученый

  • Бейли С.М., Корнфорт М.Н., Ульрих Р.Л., Гудвин Э.Х.Дисфункциональные теломеры млекопитающих соединяются с двухцепочечными разрывами ДНК. Ремонт ДНК (Amst) 2004; 3 :349–57.

    КАС Google ученый

  • Bailey SM, Meyne J, Chen DJ, и др. . Белки репарации двухцепочечных разрывов ДНК необходимы для закрытия концов хромосом млекопитающих. Proc Natl Acad Sci USA 1999; 96 :14899–904.

    КАС Google ученый

  • Лис-Миллер С.П., Годбаут Р., Чан Д.В., и др. .Отсутствие субъединицы p350 ДНК-активируемой протеинкиназы из радиочувствительной линии клеток человека. Наука 1995; 267 :1183–5.

    КАС пабмед Google ученый

  • Джилли Д., Танака Х., Ханде М.П., ​​ и др. . DNA-PKcs имеет решающее значение для покрытия теломер. Proc Natl Acad Sci USA 2001; 98 :15084–8.

    КАС пабмед Google ученый

  • Hsu HL, Gilley D, Galande SA, и др. .Ku уникальным образом действует на теломеры млекопитающих, предотвращая соединение концов. Гены Дев 2000; 14 :2807–12.

    КАС пабмед ПабМед Центральный Google ученый

  • Хсу Х.Л., Джилли Д., Блэкберн Э.Х., Чен Д.Дж. Ку связан с теломерами у млекопитающих. Proc Natl Acad Sci USA 1999; 96 :12454–8.

    КАС пабмед Google ученый

  • Samper E, Goytisolo FA, Slijepcevic P, и др. .Белок ku86 млекопитающих предотвращает слияние теломер независимо от длины повторов TTAGGG и выступающего конца G-цепи. EMBO Реп. 2000; 1 :244–52.

    КАС пабмед ПабМед Центральный Google ученый

  • Эспехель С., Франко С., Родригес-Пералес С., и др. . ku86 млекопитающих обеспечивает слияние хромосом и апоптоз, вызванный критически короткими теломерами. Embo J 2002; 21 :2207–19.

    КАС пабмед ПабМед Центральный Google ученый

  • д’Адда ди Фаганья Ф., Ханде М.П., ​​Тонг В.М., и др. . Влияние негомологичных факторов соединения концов ДНК на длину теломер и стабильность хромосом в клетках млекопитающих. Карр Биол 2001; 11 :1192–6.

    КАС пабмед Google ученый

  • Руни С., Секигучи Дж., Чжу С., и др. .Фенотип «дырявого» SCID, связанный с дефектным процессингом кодирующего конца V(D)J у мышей с дефицитом Artemis. Мол Ячейка 2002; 10 :1379–90.

    КАС пабмед Google ученый

  • Руни С., Альт Ф.В., Ломбард Д., и др. . Дефектная репарация ДНК и повышенная нестабильность генома в мышиных клетках с дефицитом Artemis. J Exp Med 2003; 197 :553–65.

    КАС пабмед ПабМед Центральный Google ученый

  • Ле С., Мур Дж. К., Хабер Дж. Э., Грейдер К. В. .RAD50 и RAD51 определяют два пути, которые совместно поддерживают теломеры в отсутствие теломеразы. Генетика 1999; 152 : 143–52.

    КАС пабмед ПабМед Центральный Google ученый

  • Киронмай К.М., Мунияппа К. Изменение теломерных последовательностей и старение, вызванное мутациями в RAD50 saccharomyces cerevisiae. Гены Клетки 1997; 2 :443–55.

    КАС пабмед Google ученый

  • Nugent CI, Bosco G, Ross LO, и др. .Поддержание теломер зависит от действий, необходимых для восстановления концов двухцепочечных разрывов. Карр Биол 1998; 8 :657–60.

    КАС пабмед Google ученый

  • Гальего ME, Белый CI . Функция RAD50 необходима для поддержания теломер у арабидопсиса. Proc Natl Acad Sci USA 2001; 98 :1711–6.

    КАС пабмед Google ученый

  • Ранганатан В., Хайне В.Ф., Чикконе Д.Н., и др. .Для восстановления дефекта длины теломер клеток синдрома разрыва Неймегена требуется NBS и каталитическая субъединица теломеразы. Карр Биол 2001; 11 :962–6.

    КАС пабмед Google ученый

  • де Ланж Т . Защита теломер млекопитающих. Онкоген 2002; 21 :532–40.

    КАС Google ученый

  • де Ланж Т .Т-петли и происхождение теломер. Nat Rev Mol Cell Biol 2004; 5 :323–9.

    КАС пабмед Google ученый

  • Касс-Эйслер А., Грейдер К.В. Рекомбинация в поддержании длины теломер. Trends Biochem Sci 2000; 25 :200–4.

    КАС пабмед Google ученый

  • Иидзима К., Комацу К., Мацуура С., Таучи Х.Ген синдрома поломки Неймегена и его роль в стабильности генома. Хромосома 2004; 113 : 53–61.

    КАС пабмед Google ученый

  • Сивицки Ю.К., Дегерман С., Хшановска К.Х., Роос Г. . Поддержание теломер и регуляция клеточного цикла в спонтанно иммортализованных линиях Т-клеток у пациентов с синдромом разрыва Неймегена. Exp Cell Res 2003; 287 : 178–89.

    КАС пабмед Google ученый

  • Нака К., Икеда К., Мотояма Н. .Рекрутирование NBS1 в онкогенные домены PML посредством взаимодействия с белком sp100. Biochem Biophys Res Commun 2002; 299 : 863–71.

    КАС пабмед Google ученый

  • Ву Г., Ли В.Х., Чен П.Л. NBS1 и TRF1 совместно локализуются в телах промиелоцитарного лейкоза во время поздних фаз S/G2 в иммортализованных теломеразо-отрицательных клетках. Участие NBS1 в альтернативном удлинении теломер. J Biol Chem 2000; 275 :30618–22.

    КАС пабмед Google ученый

  • Ву С., Ранганатан В., Вейсман Д.С., и др. . ATM-фосфорилирование белка синдрома разрыва Неймегена необходимо в ответ на повреждение ДНК. Природа 2000; 405 :477–82.

    КАС Google ученый

  • Zhu XD, Kuster B, Mann M, и др. . Регулируемая клеточным циклом ассоциация RAD50/MRE11/NBS1 с TRF2 и теломерами человека. Нат Жене 2000; 25 :347–52.

    КАС пабмед Google ученый

  • Лавин М.Ф., Шредер А.Л. Синтез устойчивой к повреждениям ДНК у эукариот. Мутат Рез 1988; 193 : 193–206.

    КАС пабмед Google ученый

  • Художник РБ, Янг Б.Р. Радиочувствительность при атаксии-телеангиэктазии: новое объяснение. Proc Natl Acad Sci USA 1980; 77 :7315–7.

    КАС Google ученый

  • Falck J, Mailand N, Syljuasen RG, и др. . Путь контрольной точки ATM-CHK2-CDC25a защищает от радиорезистентного синтеза ДНК. Природа 2001; 410 :842–7.

    КАС пабмед ПабМед Центральный Google ученый

  • Дигвид М., Сперлинг К. . Синдром разрыва Неймегена: клиническое проявление дефектного ответа на двухцепочечные разрывы ДНК. Ремонт ДНК (Amst) 2004; 3 :1207–17.

    КАС Google ученый

  • Мацуока С., Ротман Г., Огава А., и др. . Фосфорилирует CHK2 in vivo и in vitro с мутациями атаксии и телеангиэктазии. Proc Natl Acad Sci USA 2000; 97 :10389–94.

    КАС пабмед Google ученый

  • Фальк Дж., Петрини Дж.Х., Уильямс Б.Р., и др. .Контрольная точка внутри S-фазы, зависящая от повреждения ДНК, регулируется параллельными путями. Нат Жене 2002; 30 :290–4.

    ПабМед Google ученый

  • Кобаяши Дж., Анточча А., Таучи Х., и др. . NBS1 и его функциональная роль в реакции на повреждение ДНК. Ремонт ДНК (Amst) 2004; 3 :855–61.

    КАС Google ученый

  • Наканиши К., Танигучи Т., Ранганатан В., и др. .Взаимодействие FANCD2 и NBS1 в реакции на повреждение ДНК. Nat Cell Biol 2002; 4 :913–20.

    КАС пабмед Google ученый

  • Литтл Дж.Б., Нагасава Х., Дальберг В.К., и др. . Различная реакция клеток синдрома разрыва Неймегена и атаксии-телеангиэктазии на ионизирующее излучение. Radiat Res 2002; 158 :319–26.

    КАС пабмед Google ученый

  • Анточча А., Штумм М., Саар К., и др. .Нарушенная p53-опосредованная реакция на повреждение ДНК, нарушение клеточного цикла и хромосомные аберрации в лимфобластоидных клеточных линиях с синдромом разрыва Неймегена. Int J Radiat Biol 1999; 75 :583–91.

    КАС Google ученый

  • Салливан К.Е., Векслер Э., Ледерман Х., Лис-Миллер С.П. Контрольные точки клеточного цикла и репарация ДНК при синдроме разрыва Неймегена. Clin Immunol Immunopathol 1997; 82 :43–8.

    КАС пабмед Google ученый

  • Ямадзаки В., Вегнер Р.Д., Кирхгесснер CU . Характеристика ответов контрольных точек клеточного цикла после ионизирующего излучения в клетках синдрома разрушения Неймегена. Рак Res 1998; 58 :2316–22.

    КАС пабмед Google ученый

  • Сюй Б., Ким С., Кастан М.Б. Участие BRCA1 в контрольных точках S-фазы и G(2)-фазы после ионизирующего облучения. Mol Cell Biol 2001; 21 :3445–50.

    КАС пабмед ПабМед Центральный Google ученый

  • Чен Л., Трухильо К., Рамос В., и др. . Продвижение катализируемого DN14 соединения концов ДНК с помощью комплексов RAD50/MRE11/XRS2 и HDF11/HDF2. Мол Ячейка 2001; 8 :1105–15.

    КАС пабмед Google ученый

  • Checkpoint Surgical завершает финансирование акционерного капитала на сумму 16 миллионов долларов США для стимулирования роста и запуска новых продуктов

    КЛИВЛАНД, Огайо – Checkpoint Surgical, Inc., частная американская компания по производству медицинского оборудования с запатентованной технологией нейростимуляции для защиты и восстановления нервов, объявила сегодня о завершении привлечения капитала в размере 16 миллионов долларов под руководством River Cities Capital, расположенной в Цинциннати инвестиционной компании, ориентированной на здравоохранение. В раунде также приняли участие существующие спонсоры, в том числе венчурные фонды Mutual Capital Partners и JumpStart NEXT Fund из Кливленда, First Analysis, инвестиционная компания, базирующаяся в Чикаго, и несколько других инвесторов.

    «Rivers Cities рады сотрудничать с командой Checkpoint в этом быстро развивающемся секторе.Наше рыночное и клиническое усердие подтвердило лидерство Checkpoint в секторе ухода за нервами, а наши предыдущие итерации с управленческой командой вселили в нас большую уверенность в их способности реализовать эту возможность. Мы находимся на начальном этапе управления периферическими нервами, и Checkpoint станет важным фактором в будущем», — сказал Картер Макнабб, управляющий директор River Cities Capital.

    «Мы воочию стали свидетелями впечатляющего роста и развития лидирующей позиции Checkpoint в области лечения периферических нервов.Мы с нетерпением ждем продолжения нашего партнерства с Checkpoint и теперь приветствуем River Cities Capital в команде», — сказал Уэйн Уоллес, управляющий директор Mutual Capital Partners, который сыграл важную роль в привлечении River Cities к столу переговоров.

    Капитал роста будет использован для поддержки расширения отдела продаж Checkpoint и запуска нескольких новых продуктов, в том числе недавно приобретенного нервного бинта NeuroShield, а также для подпитки продолжающихся исследований и разработок. Checkpoint Surgical имеет специализированный, преданный своему делу отдел продаж, насчитывающий 30 человек и постоянно растущий, а также значительную междисциплинарную команду по исследованиям и разработкам, которая хорошо оснащена для быстрого масштабирования бизнеса.

    «Сегодня специалисты по лечению нервов делают удивительные вещи в области защиты и восстановления нервов, но они хотят сделать еще больше для повышения качества жизни своих пациентов. Мы тоже этого хотим и верим, что можем помочь», — сказал президент и генеральный директор Checkpoint Лен Косентино. «Это финансирование будет способствовать прогрессу в области лечения периферических нервов, которого мы добиваемся в сотрудничестве со специалистами по уходу за нервами посредством инновационных исследований и разработки продуктов».

    О компании River Cities Capital

    River Cities — растущая акционерная компания, инвестирующая в перспективные компании на стыке здравоохранения и технологий.Мы стремимся быть в первую очередь деловым партнером, а во вторую — поставщиком капитала, инвестируя значительный человеческий капитал, чтобы использовать наш опыт в данной области, сеть лидеров мнений в области здравоохранения и тесные отношения с системами здравоохранения, сложившиеся за нашу 27-летнюю историю. Имея более 750 миллионов долларов привлеченного капитала и последовательный послужной список успеха, фирма зарекомендовала себя как предпочтительный источник капитала для роста. Мы активно ищем новые портфельные компании для нашего фонда $200M Fund VI. Для получения дополнительной информации посетите сайт www.rccf.com.

    О фондах Mutual Capital Partners

    Фонды Mutual Capital Partners инвестируют в быстрорастущие технологические предприятия после получения дохода. Инвесторы MCPF — успешные руководители со всех уголков США, которые объединяют лучшие элементы ангельского фонда в профессионально управляемые венчурные фонды с привлеченным капиталом. Для получения дополнительной информации о Mutual Capital Partners посетите сайт www.mutualcapitalpartners.com.

    О первом анализе

    First Analysis инвестирует в основном в Соединенные Штаты, уделяя особое внимание технологиям/программному обеспечению, здравоохранению и экологическим технологиям.Мы помогаем существующим компаниям стать прибыльными лидерами на крупных рынках, финансируя планы роста и тесно сотрудничая с руководством в таких областях, как стратегия, подбор персонала, продажи и маркетинг, а также корпоративное развитие. Наш гибкий подход направлен на инвестирование от 3 до 10 миллионов долларов США в качестве ведущего инвестора или в качестве партнера по синдикату, который предлагает ценную перспективу. Для получения дополнительной информации посетите сайт www.firstanalysis.com.

    О фонде JumpStart NEXT

    JumpStart NEXT Fund — это коммерческий венчурный фонд с капиталом 20 млн долларов, ориентированный на технологические стартапы на ранней стадии, расположенный в Огайо.Фонд предназначен для инвестиций серии А, обычно в диапазоне от 500 000 до 1,5 млн долларов США, и стремится инвестировать в компании, которые демонстрируют опытное лидерство, устойчивые конкурентные преимущества, большие адресные рынки, капиталоэффективные бизнес-модели и значительный потенциал выхода. Узнайте больше о фонде NEXT и других инвестиционных инструментах JumpStart на www.jumpstartinc.org/investments.

    Автономный поток контрольной точки завершает работу без предоставления подробной информации об исключении в SQL Server 2014

    Симптомы

    Предположим, что у вас есть база данных с оптимизированной для памяти файловой группой в Microsoft SQL Server 2014.Журнал транзакций может продолжать увеличиваться, и вы не сможете урезать или сжать журнал. Если вы столкнулись с этой проблемой, вы увидите следующие симптомы:

    • Представление каталога sys.databases сообщает log_reuse_wait_desc как «XTP_CHECKPOINT».

       Выберите имя, log_reuse_wait_desc из sys.databases, где name='' 
    • Операция ручной контрольной точки для затронутой базы данных завершается сбоем, и вы получаете следующее сообщение об ошибке:

      Сообщение 41315, уровень 16, состояние 4, строка N
      Ошибка операции контрольной точки в базе данных <имя базы данных>.

    • Не удается найти поток автономной контрольной точки, соответствующий затронутой базе данных.

       Выберите db_name(database_id) в качестве DatabaseName, * из sys.dm_exec_requests, где команда = 'XTP_OFFLINE_CKPT' 
    • Запрос статистики об операции контрольной точки OLTP в памяти для затронутой базы данных возвращает 0 для каждого столбца:

       Выберите * из sys.dm_db_xtp_checkpoint_stats 

    Разрешение

    Проблема была впервые исправлена ​​в следующих накопительных обновлениях SQL Server:

    Рекомендация: установите последнее накопительное обновление для SQL Server

    Каждое новое накопительное обновление для SQL Server содержит все исправления и все исправления безопасности, которые были включены в предыдущее накопительное обновление.Мы рекомендуем вам загрузить и установить последние накопительные обновления для SQL Server:

    .

    Обходной путь

    Чтобы обойти эту проблему, переведите затронутую базу данных в автономный режим, а затем снова в оперативный режим, или утилизируйте экземпляр SQL Server.

    Примечание Журнал транзакций может быть усечен или уменьшен. Однако проблема может повториться, пока не будет применено исправление.

    Статус

    Корпорация Майкрософт подтвердила, что это проблема продуктов Майкрософт, перечисленных в разделе «Относится к».

    Развитие комбинированной терапии блокады иммунных контрольных точек с помощью ингибиторов репарации повреждений ДНК для лечения рака молочной железы и яичников | Journal of Hematology & Oncology

  • Ott PA, Bang YJ, Piha-Paul SA, Razak ARA, Bennona J, Soria JC, et al. Профиль экспрессии генов воспаленных Т-клеток, экспрессия лиганда 1 запрограммированной смерти и мутационная нагрузка опухоли предсказывают эффективность у пациентов, получавших пембролизумаб при 20 видах рака: KEYNOTE-028.Дж. Клин Онкол. 2019;37(4):318–27.

    ПабМед Google ученый

  • Christofi T, Baritaki S, Falzone L, Libra M, Zaravinos A. Современные перспективы иммунотерапии рака. Раков (Базель). 2019;11(10):66.

    Google ученый

  • Magaway C, Kim E, Jacinto E. Ориентация на mTOR и метаболизм при раке: уроки и инновации. Клетки. 2019;8(12):66.

    Google ученый

  • Лазарус Г., Одри Дж., Искандар AWB.Профили эффективности и безопасности ингибиторов запрограммированной гибели клеток-1/лиганда запрограммированной гибели клеток-1 при лечении тройного негативного рака молочной железы: всесторонний систематический обзор. Oncol Rev. 2019;13(2):425.

    КАС пабмед ПабМед Центральный Google ученый

  • Ли Э.К., Константинопулос П.А. Комбинированное ингибирование PARP и иммунных контрольных точек при раке яичников. Тенденции Рак. 2019;5(9):524–8.

    КАС пабмед Google ученый

  • Mouw KW, Goldberg MS, Konstantinopoulos PA, D’Andrea AD.Повреждение ДНК и восстановление биомаркеров ответа на иммунотерапию. Рак Дисков. 2017;7(7):675–93.

    КАС пабмед ПабМед Центральный Google ученый

  • Mouw KW, D’Andrea AD. Дефицит репарации ДНК и ответ иммунотерапии. Дж. Клин Онкол. 2018;36(17):1710–3.

    КАС пабмед Google ученый

  • Pilzecker B, Buoninfante OA, Jacobs H. Толерантность к повреждению ДНК в стволовых клетках, старение, мутагенез, болезни и лечение рака.Нуклеиновые Кислоты Res. 2019;47(14):7163–81.

    КАС пабмед ПабМед Центральный Google ученый

  • Пили П.Г., Тан С., Миллс Г.Б., Яп Т.А. Современные стратегии воздействия на реакцию повреждения ДНК при раке. Nat Rev Clin Oncol. 2019;16(2):81–104.

    КАС пабмед ПабМед Центральный Google ученый

  • Ли Э.К., Константинопулос П.А. Ингибирование PARP и иммуномодуляция: научное обоснование и перспективы лечения онкогинекологических заболеваний.The Adv Med Oncol. 2020;12:1758835

    4116.

    КАС пабмед ПабМед Центральный Google ученый

  • Стюарт Р.А., Пили П.Г., Яп Т.А. Разработка комбинаций PARP и ингибиторов иммунных контрольных точек. Рак рез. 2018;78(24):6717–25.

    КАС пабмед Google ученый

  • Turajlic S, Litchfield K, Xu H, Rosenthal R, McGranahan N, Reading JL, et al.Опухолеспецифические неоантигены, полученные из вставок и делеций, и иммуногенный фенотип: панраковый анализ. Ланцет Онкол. 2017;18(8):1009–21.

    КАС пабмед Google ученый

  • Кастровьехо-Бермехо М., Крус К., Ллоп-Гевара А., Гутьеррес-Энрикес С., Дьюси М., Ибрагим Ю. Х. и др. Анализ RAD51, доступный в обычных образцах опухолей, вызывает ответ ингибитора PARP за пределами мутации BRCA. EMBO Мол Мед. 2018;10(12):66.

    Google ученый

  • Чжао Э.Ю., Шэнь Ю., Плезанс Э., Касаян К., Лилакумари С., Джонс М. и др.Дефицит гомологичной рекомбинации и результаты терапии на основе платины при распространенном раке молочной железы. Клин Рак Рез. 2017;23(24):7521–30.

    КАС пабмед Google ученый

  • Константинопулос П.А., Чеккальди Р., Шапиро Г.И., Д’Андреа А.Д. Дефицит гомологичной рекомбинации: использование фундаментальной уязвимости рака яичников. Рак Дисков. 2015;5(11):1137–54.

    КАС пабмед ПабМед Центральный Google ученый

  • Чопра Н., Тови Х., Пирсон А., Каттс Р., Томс С., Прошек П. и др.Дефицит восстановления гомологичной рекомбинации ДНК и ингибирующая активность PARP при первичном тройном негативном раке молочной железы. Нац коммун. 2020;11(1):2662.

    КАС пабмед ПабМед Центральный Google ученый

  • Сантана Дос Сантос Э., Лаллеманд Ф., Петалот А., Капуто С.М., Руло Э. HRness в области рака молочной железы и яичников. Int J Mol Sci. 2020;21(11):66.

    Google ученый

  • Цетин Б., Вабл К.А., Гумусай О.Революция, разрушающая ДНК. Crit Rev Oncol Hematol. 2020;156:103117.

    ПабМед Google ученый

  • Брайант С., Роулинсон Р., Мэсси А.Дж. Ингибирование Chk1 как новая терапевтическая стратегия для лечения тройного негативного рака молочной железы и яичников. БМК Рак. 2014;14:570.

    ПабМед ПабМед Центральный Google ученый

  • Клири Дж. М., Агирре А. Дж., Шапиро Г. И., Д’Андреа А. Д.Разработка ингибиторов репарации ДНК на основе биомаркеров. Мол Ячейка. 2020;78(6):1070–85.

    КАС пабмед ПабМед Центральный Google ученый

  • Torre LA, Trabert B, DeSantis CE, Miller KD, Samimi G, Runowicz CD, et al. Статистика рака яичников, 2018 г. CA Cancer J Clin. 2018;68(4):284–96.

    ПабМед ПабМед Центральный Google ученый

  • Swisher EM, Lin KK, Oza AM, Scott CL, Giordano H, Sun J, et al.Рукапариб при рецидиве чувствительной к платине карциномы яичников высокой степени злокачественности (ARIEL2, часть 1): международное, многоцентровое, открытое исследование, фаза 2. Ланцет Онкол. 2017;18(1):75–87.

    КАС пабмед ПабМед Центральный Google ученый

  • Кристелейт Р.С., Шапира-Фроммер Р., Окнин А., Балманья Дж., Рэй-Коквард И., Домчек С. и др. Клиническая активность ингибитора поли(АДФ-рибозо)полимеразы (PARP) рукапариба у пациентов (pts) с раком яичников высокой степени злокачественности (HGOC) и мутацией BRCA (BRCAmut): анализ объединенных данных исследования 10 (части 1, 2a). , и 3) и АРИЭЛ2 (части 1 и 2).2016;27(приложение_6).

  • Мур К., Коломбо Н., Скамбия Г., Ким Б.Г., Окнин А., Фридлендер М. и др. Поддерживающая терапия олапарибом у пациентов с впервые диагностированным распространенным раком яичников. N Engl J Med. 2018;379(26):2495–505.

    КАС пабмед Google ученый

  • Ray-Coquard I, Pautier P, Pignata S, Perol D, Gonzalez-Martin A, Berger R, et al. Олапариб плюс бевацизумаб в качестве поддерживающей терапии первой линии при раке яичников. N Engl J Med.2019;381(25):2416–28.

    КАС пабмед Google ученый

  • Ledermann J, Harter P, Gourley C, Friedlander M, Vergote I, Rustin G, et al. Поддерживающая терапия олапарибом при чувствительном к платине рецидиве рака яичников. N Engl J Med. 2012;366(15):1382–92.

    КАС пабмед Google ученый

  • Ledermann J, Harter P, Gourley C, Friedlander M, Vergote I, Rustin G, et al.Поддерживающая терапия олапарибом у пациентов с чувствительным к препаратам платины рецидивирующим серозным раком яичников: предварительно спланированный ретроспективный анализ исходов по статусу BRCA в рандомизированном исследовании 2 фазы. Ланцет Онкол. 2014;15(8):852–61.

    КАС пабмед Google ученый

  • Коулман Р.Л., Оза А.М., Лоруссо Д., Агаджанян С., Окнин А., Дин А. и др. Поддерживающая терапия рукапарибом рецидивирующей карциномы яичников после ответа на терапию препаратами платины (ARIEL3): рандомизированное двойное слепое плацебо-контролируемое исследование фазы 3.Ланцет. 2017;390(10106):1949–61.

    КАС пабмед ПабМед Центральный Google ученый

  • Мирза М.Р., Монк Б.Дж., Херрштедт Дж., Оза А.М., Махнер С., Редондо А. и др. Поддерживающая терапия нирапарибом при чувствительном к платине рецидивирующем раке яичников. N Engl J Med. 2016;375(22):2154–64.

    КАС пабмед Google ученый

  • Баркал А.А., Брюэр Р.Е., Маркович М., Коварский М., Баркал С.А., Заро Б.В. и др.Передача сигналов CD24 через макрофаг Siglec-10 является мишенью для иммунотерапии рака. Природа. 2019;572(7769):392–6.

    КАС пабмед ПабМед Центральный Google ученый

  • Timperi E, Vissio E, Marchio C, Romano E. Иммунный ландшафт при раке у женщин. Лечение рака Res. 2020;180:215–49.

    КАС пабмед Google ученый

  • Робсон М., Им С.А., Сенкус Э., Сюй Б., Домчек С.М., Масуда Н. и др.Олапариб для лечения метастатического рака молочной железы у пациентов с зародышевой мутацией BRCA. N Engl J Med. 2017;377(6):523–33.

    КАС пабмед Google ученый

  • Litton JK, Rugo HS, Ettl J, Hurvitz SA, Goncalves A, Lee KH, et al. Талазопариб у пациентов с распространенным раком молочной железы и мутацией BRCA зародышевой линии. N Engl J Med. 2018;379(8):753–63.

    КАС пабмед Google ученый

  • Такахаши Н., Суролия И., Томас А.Ориентация на репарацию ДНК для стимулирования иммунных ответов: пришло время пересмотреть стратегию клинической трансляции. Клин Рак Рез. 2020;6:66.

    Google ученый

  • Яп Т.А., Пламмер Р., Азад Н.С., Хелледей Т. Революция, повреждающая ДНК: ингибиторы PARP и не только. Книга Am Soc Clin Oncol Educ. 2019;39:185–95.

    ПабМед Google ученый

  • Мин. A, Im SA. Ингибиторы PARP как терапевтические средства: помимо модуляции PARylation.Раки. 2020;12(2):66.

    Google ученый

  • He Q, Jiang X, Zhou X, Weng J. Борьба с раком посредством взаимодействия TCR-пептид/MHC. J Гематол Онкол. 2019;12(1):139.

    КАС пабмед ПабМед Центральный Google ученый

  • Ян К., Цао В., Ван З., Чжан Б., Лю Дж. Регуляция иммунного ускользания от рака: роль микроРНК в белках иммунных контрольных точек. Рак Летт.2018; 431:73–84.

    КАС пабмед Google ученый

  • Эсенстен Дж. Х., Хелоу Ю. А., Чопра Г., Вайс А., Блюстоун Дж. А. Костимуляция CD28: от механизма к терапии. Иммунитет. 2016;44(5):973–88.

    КАС пабмед ПабМед Центральный Google ученый

  • Цинь С., Сюй Л., Йи М., Ю С., Ву К., Луо С. Новые иммунные контрольные точки: выход за рамки PD-1 и CTLA-4. Мол Рак.2019;18(1):155.

    ПабМед ПабМед Центральный Google ученый

  • Топалян С.Л., Дрейк К.Г., Пардолл Д.М. Блокада иммунных контрольных точек: общий подход к терапии рака. Раковая клетка. 2015;27(4):450–61.

    КАС пабмед ПабМед Центральный Google ученый

  • Гринвальд Р.Дж., Фриман Г.Дж., Шарп А.Х. Возвращение к семейству B7. Анну Рев Иммунол.2005; 23: 515–48.

    ПабМед Google ученый

  • Налласами П., Чава С., Верма С.С., Мишра С., Горантла С., Коултер Д.В. и др. PD-L1, воспаление, некодирующие РНК и нейробластома: перспектива иммуноонкологии. Семин Рак Биол. 2018; 52 (часть 2): 53–65.

    КАС пабмед Google ученый

  • Фукумура Д., Клоппер Дж., Амузгар З., Дуда Д.Г., Джейн Р.К. Усиление иммунотерапии рака с использованием антиангиогенных средств: возможности и проблемы.Nat Rev Clin Oncol. 2018;15(5):325–40.

    КАС пабмед ПабМед Центральный Google ученый

  • Кинан Т.Э., Толани С.М. Роль иммунотерапии при трижды негативном раке молочной железы. J Natl Compr Canc Netw. 2020;18(4):479–89.

    КАС пабмед Google ученый

  • Ян С., Ся Б.Р., Чжан З.С., Чжан Ю.Дж., Лу Г., Джин В.Л. Иммунотерапия рака яичников: адъювантная, комбинированная и неоадъювантная.Фронт Иммунол. 2020; 11: 577–869.

    Google ученый

  • ван Дейк Н., Фант С.А., Бланк С.Ю., Поулз Т., Розенберг Дж.Е., ван дер Хейден М.С. Иммунограмма рака как основа персонализированной иммунотерапии при уротелиальном раке. Евр Урол. 2019;75(3):435–44.

    ПабМед Google ученый

  • Park S, Lee H, Lee B, Lee SH, Sun JM, Park WY и др. Реакция на повреждение ДНК и изменение путей репарации и ее связь с бременем опухолевых мутаций и химиотерапией на основе платины при SCLC.Дж. Торак Онкол. 2019;14(9):1640–50.

    КАС пабмед Google ученый

  • Li A, Yi M, Qin S, Chu Q, Luo S, Wu K. Перспективы сочетания блокады иммунных контрольных точек с ингибированием PARP. J Гематол Онкол. 2019;12(1):98.

    ПабМед ПабМед Центральный Google ученый

  • Шевцов М., Сато Х., Малтхофф Г., Шибата А. Новые подходы к повышению эффективности иммуно-лучевой терапии.Фронт Онкол. 2019;9:156.

    ПабМед ПабМед Центральный Google ученый

  • Dillon MT, Bergerhoff KF, Pedersen M, Whittock H, Crespo-Rodriguez E, Patin EC, et al. Ингибирование ATR потенцирует радиационно-индуцированное воспалительное микроокружение опухоли. Клин Рак Рез. 2019;25(11):3392–403.

    КАС пабмед ПабМед Центральный Google ученый

  • Сен Т., Делла Корте К.М., Милутинович С., Карднелл Р.Дж., Диао Л., Рамкумар К. и др.Комбинированное лечение пероральным ингибитором CHK1, SRA737 и низкими дозами гемцитабина усиливает эффект блокады лиганда 1 запрограммированной смерти путем модулирования иммунного микроокружения при SCLC. Дж. Торак Онкол. 2019;14(12):2152–63.

    КАС пабмед ПабМед Центральный Google ученый

  • Скулидис Ф., Голдберг М.Э., Гринавальт Д.М., Хеллманн М.Д., Авад М.М., Гейнор Дж.Ф. и др. Мутации STK11/LKB1 и резистентность к ингибитору PD-1 при KRAS-мутантной аденокарциноме легкого.Рак Дисков. 2018;8(7):822–35.

    КАС пабмед ПабМед Центральный Google ученый

  • Ricciuti B, Recondo G, Spurr LF, Li YY, Lamberti G, Venkatraman D, et al. Влияние мутаций гена ответа на повреждение ДНК и восстановления (DDR) на эффективность ингибирования иммунных контрольных точек PD-(L) 1 при немелкоклеточном раке легкого. Клин Рак Рез. 2020;6:66.

    Google ученый

  • Хавел Дж.Дж., Чоуэлл Д., Чан Т.А.Развивающийся ландшафт биомаркеров для иммунотерапии ингибиторами контрольных точек. Нат Рев Рак. 2019;19(3):133–50.

    КАС пабмед ПабМед Центральный Google ученый

  • Mandal R, Samstein RM, Lee KW, Havel JJ, Wang H, Krishna C, et al. Генетическое разнообразие опухолей с дефицитом репарации неправильного спаривания влияет на ответ на иммунотерапию против PD-1. Наука. 2019;364(6439):485–91.

    КАС пабмед ПабМед Центральный Google ученый

  • Chalabi M, Fanchi LF, Dijkstra KK, Van den Berg JG, Aalbers AG, Sikorska K, et al.Неоадъювантная иммунотерапия приводит к патологическим реакциям при раке толстой кишки на ранней стадии с MMR- и MMR-дефицитом. Нат Мед. 2020;26(4):566–76.

    КАС пабмед Google ученый

  • Александров Л.Б., Ник-Зайнал С., Ведж Д.С., Апарисио С.А., Бехяти С., Бьянкин А.В., и др. Признаки мутационных процессов при раке человека. Природа. 2013; 500(7463):415–21.

    КАС пабмед ПабМед Центральный Google ученый

  • McGranahan N, Furness AJ, Rosenthal R, Ramskov S, Lyngaa R, Saini SK, et al.Клональные неоантигены вызывают иммунореактивность Т-клеток и чувствительность к блокаде иммунных контрольных точек. Наука. 2016;351(6280):1463–9.

    КАС пабмед ПабМед Центральный Google ученый

  • Miao D, Margolis CA, Vokes NI, Liu D, Taylor-Weiner A, Wankowicz SM, et al. Геномные корреляты ответа на блокаду иммунных контрольных точек в микросателлитно-стабильных солидных опухолях. Нат Жене. 2018;50(9):1271–81.

    КАС пабмед ПабМед Центральный Google ученый

  • Су Р.А.Пролить свет на молекулярные детерминанты ответа на терапию анти-PD-1. Transl Lung Cancer Res. 2015;4(6):816–9.

    КАС пабмед ПабМед Центральный Google ученый

  • Conway JR, Kofman E, Mo SS, Elmarakeby H, Van Allen E. Геномика ответа на иммунную контрольную терапию рака: последствия для прецизионной медицины. Геном Мед. 2018;10(1):93.

    КАС пабмед ПабМед Центральный Google ученый

  • Тан Ф, Чжэн П.Опухолевые клетки по сравнению с иммунными клетками хозяина: чей PD-L1 способствует иммунотерапии рака, опосредованной блокадой PD-1/PD-L1? Клетка Биоски. 2018;8:34.

    ПабМед ПабМед Центральный Google ученый

  • Lai Q, Wang H, Li A, Xu Y, Tang L, Chen Q и др. Децитибин повышает эффективность анти-PD-1 терапии за счет активации ответа клеток рака легкого на сигнал IFN/PD-L1. Онкоген. 2018;37(17):2302–12.

    КАС пабмед Google ученый

  • Salgado R, Denkert C, Demaria S, Sirtaine N, Klauschen F, Pruneri G, et al.Оценка инфильтрирующих опухоль лимфоцитов (TIL) при раке молочной железы: рекомендации Международной рабочей группы TIL 2014. Ann Oncol. 2015;26(2):259–71.

    КАС пабмед Google ученый

  • Воронецка К.И., Родин К.Е., Чонгсатидкиет П., Кейт К.А., Феччи П.Е. Дисфункция Т-клеток при глиобластоме: применение новой концепции. Клин Рак Рез. 2018;24(16):3792–802.

    КАС пабмед ПабМед Центральный Google ученый

  • Zhu J, Petit PF, Van den Eynde BJ.Апоптоз инфильтрирующих опухоль Т-лимфоцитов: новый механизм иммунных контрольных точек. Рак Иммунол Иммунотер. 2019;68(5):835–47.

    КАС пабмед Google ученый

  • Cao D, Zhao J, Nguyan LN, Nguyen LNT, Khanal S, Dang X, et al. Нарушение целостности теломер и механизмов репарации ДНК с помощью KML001 вызывает старение Т-клеток, апоптоз и клеточные дисфункции. Фронт Иммунол. 2019;10:1152.

    КАС пабмед ПабМед Центральный Google ученый

  • Буларес А.Х., Яковлев А.Г., Иванова В., Стойка Б.А., Ван Г., Айер С. и другие.Роль расщепления поли(АДФ-рибозо)полимеразы (PARP) в апоптозе. Устойчивый к каспазе 3 мутант PARP увеличивает скорость апоптоза в трансфицированных клетках. Дж. Биол. Хим. 1999;274(33):22932–40.

    КАС пабмед Google ученый

  • Браун Дж. С., Сундар Р., Лопес Дж. Сочетание терапии, повреждающей ДНК, с иммунотерапией: больше поспешности, меньше скорости. Бр Дж Рак. 2018;118(3):312–24.

    КАС пабмед Google ученый

  • Апциаури Н., Руис-Кабельо Ф., Гарридо Ф.Переход от HLA-I-положительных к HLA-I-отрицательным первичным опухолям: путь ускользания от ответов Т-клеток. Курр Опин Иммунол. 2018;51:123–32.

    КАС пабмед Google ученый

  • Mu C, Zhang X, Wang L, Xu A, Ahmed KA, Pang X, et al. Усиленное подавление поликлональных регуляторных Т-клеток CD8(+)25(+) за счет экзосомального вооружения комплексов антиген-специфический пептид/МНС. Дж. Лейкок Биол. 2017;101(5):1221–31.

    КАС пабмед Google ученый

  • Vendetti FP, Karukonda P, Clump DA, Teo T, Lalonde R, Nugent K, et al.Ингибитор киназы ATR AZD6738 усиливает противоопухолевую активность CD8+ Т-клеток после облучения. Джей Клин Инвест. 2018;128(9):3926–40.

    ПабМед ПабМед Центральный Google ученый

  • Ван И, Линь Икс, Цяо С.Л., Ан Х.В., Ма И, Цяо Зи и др. Полимерные наночастицы способствуют реверсии макрофагов с фенотипов М2 на М1 в микроокружении опухоли. Биоматериалы. 2017; 112:153–63.

    КАС пабмед Google ученый

  • Мантовани А., Маркези Ф., Малески А., Лаги Л., Аллавена П.Опухолеассоциированные макрофаги как мишени лечения в онкологии. Nat Rev Clin Oncol. 2017;14(7):399–416.

    КАС пабмед ПабМед Центральный Google ученый

  • Stiff A, Trikha P, Wesolowski R, Kendra K, Hsu V, Uppati S, et al. Супрессорные клетки миелоидного происхождения экспрессируют тирозинкиназу Брутона и могут быть истощены у носителей опухоли при лечении ибрутинибом. Рак рез. 2016;76(8):2125–36.

    КАС пабмед ПабМед Центральный Google ученый

  • Кобаяши Ю., Лим С.О., Ямагути Х.Онкогенные сигнальные пути, связанные с уклонением от иммунитета и устойчивостью к ингибиторам иммунных контрольных точек при раке. Семин Рак Биол. 2019;6:66.

    Google ученый

  • Лю П., Ченг Х., Робертс Т.М., Чжао Дж.Дж. Нацеливание на путь фосфоинозитид-3-киназы при раке. Nat Rev Drug Discov. 2009;8(8):627–44.

    КАС пабмед ПабМед Центральный Google ученый

  • Миллис С.З., Икеда С., Редди С., Гаталика З., Курцрок Р.Ландшафт изменений пути фосфатидилинозитол-3-киназы в 19784 различных солидных опухолях. JAMA Онкол. 2016;2(12):1565–73.

    ПабМед Google ученый

  • Бянь С., Гао Дж., Луо Ф., Жуй С., Чжэн Т., Ван Д. и др. Дефицит PTEN повышает чувствительность эндометриоидного рака эндометрия к ингибированию соединения PARP-PI3K, но не к ингибированию PARP в качестве монотерапии. Онкоген. 2018;37(3):341–51.

    КАС пабмед Google ученый

  • Маккейб Н., Ханна С., Уокер С.М., Гонда Д., Ли Дж., Викстром К. и др.Механистическое обоснование нацеливания на опухолевые клетки с дефицитом PTEN с помощью ингибиторов киназы ответа на повреждение ДНК ATM. Рак рез. 2015;75(11):2159–65.

    КАС пабмед Google ученый

  • Китадзима С., Иванова Э., Го С., Йошида Р., Камписи М., Сундарараман С.К. и др. Подавление STING, связанное с потерей LKB1, при раке легкого, вызванном KRAS. Рак Дисков. 2019;9(1):34–45.

    КАС пабмед Google ученый

  • Толба М.Ф., Омар Х.А.Иммунотерапия, развивающийся подход к лечению тройного негативного рака молочной железы: преобразование неответчиков в ответивших. Crit Rev Oncol Hematol. 2018;122:202–7.

    ПабМед Google ученый

  • McLaughlin M, Patin EC, Pedersen M, Wilkins A, Dillon MT, Melcher AA, et al. Ремоделирование воспалительного микроокружения опухолевыми клетками после лучевой терапии. Нат Рев Рак. 2020;20(4):203–17.

    КАС пабмед Google ученый

  • Кинан Т.Э., Берк К.П., Ван Аллен Э.М.Геномные корреляты ответа на блокаду иммунных контрольных точек. Нат Мед. 2019;25(3):389–402.

    КАС пабмед ПабМед Центральный Google ученый

  • Рибас А., Волчок Ю.Д. Иммунотерапия рака с использованием блокады контрольных точек. Наука. 2018;359(6382):1350–5.

    КАС пабмед ПабМед Центральный Google ученый

  • Strickland KC, Howitt BE, Shukla SA, Rodig S, Ritterhouse LL, Liu JF, et al.Ассоциация и прогностическое значение мутационного статуса BRCA1/2 с неоантигенной нагрузкой, количеством инфильтрирующих опухоль лимфоцитов и экспрессией PD-1/PD-L1 при серозном раке яичников высокой степени. Онкотаргет. 2016;7(12):13587–98.

    ПабМед ПабМед Центральный Google ученый

  • Мин А, Ким К, Чжон К, Чхве С, Ким С, Сух КДж и др. Оценка дефицита гомологичной репарации для выявления рака молочной железы с дефектной реакцией на повреждение ДНК.Научный доклад 2020; 10 (1): 12506.

    КАС пабмед ПабМед Центральный Google ученый

  • Denkert C, Liedtke C, Tutt A, von Minckwitz G. Молекулярные изменения при тройном негативном раке молочной железы — путь к новым стратегиям лечения. Ланцет. 2017;389(10087):2430–42.

    КАС пабмед Google ученый

  • Milanesio MC, Giordano S, Valabrega G. Клинические последствия дефектов репарации ДНК при высокозлокачественных серозных карциномах яичников.Раки. 2020;12(5):66.

    Google ученый

  • Le DT, Durham JN, Smith KN, Wang H, Bartlett BR, Aulakh LK, et al. Дефицит репарации несоответствия предсказывает реакцию солидных опухолей на блокаду PD-1. Наука. 2017;357(6349):409–13.

    КАС пабмед ПабМед Центральный Google ученый

  • Le DT, Uram JN, Wang H, Bartlett BR, Kemberling H, Eyring AD, et al. Блокада PD-1 в опухолях с дефицитом репарации несоответствия.N Engl J Med. 2015;372(26):2509–20.

    КАС пабмед ПабМед Центральный Google ученый

  • Davies H, Morganella S, Purdie CA, Jang SJ, Borgen E, Russnes H, et al. Полногеномное секвенирование выявляет рак молочной железы с дефицитом репарации несоответствия. Рак рез. 2017;77(18):4755–62.

    КАС пабмед Google ученый

  • Howitt BE, Strickland KC, Sholl LM, Rodig S, Ritterhouse LL, Chowdhury D, et al.Светлоклеточный рак яичников с микросателлитной нестабильностью: уникальное подмножество рака яичников с повышенным количеством инфильтрирующих опухоль лимфоцитов и экспрессией PD-1/PD-L1. Онкоиммунология. 2017;6(2):e1277308.

    ПабМед ПабМед Центральный Google ученый

  • Иоанниду А., Гульельмаки Э., Гаринис Г.А. Повреждение ДНК: от хронического воспаления до старческого износа. Фронт Жене. 2016;7:187.

    ПабМед ПабМед Центральный Google ученый

  • McGrail DJ, Federico L, Li Y, Dai H, Lu Y, Mills GB, et al.Мультиомический анализ выявляет неоантиген-независимую инфильтрацию иммунных клеток при раке, обусловленном числом копий. Нац коммун. 2018;9(1):1317.

    ПабМед ПабМед Центральный Google ученый

  • Jiao S, Xia W, Yamaguchi H, Wei Y, Chen MK, Hsu JM, et al. Ингибитор PARP повышает экспрессию PD-L1 и усиливает иммуносупрессию, связанную с раком. Клин Рак Рез. 2017;23(14):3711–20.

    КАС пабмед ПабМед Центральный Google ученый

  • Майя-Мендоза А., Мудри П., Мерчут-Майя Дж.М., Ли М., Штраус Р., Бартек Дж.Высокая скорость разветвления вызывает стресс репликации ДНК и нестабильность генома. Природа. 2018;559(7713):279–84.

    КАС пабмед Google ученый

  • Сато Х., Джегго П.А., Шибата А. Регуляция экспрессии лиганда запрограммированной смерти 1 в ответ на повреждение ДНК в раковых клетках: значение для точной медицины. Онкологические науки. 2019;110(11):3415–23.

    КАС пабмед ПабМед Центральный Google ученый

  • Pantelidou C, Sonzogni O, De Oliveria TM, Mehta AK, Kothari A, Wang D, et al.Эффективность ингибитора PARP зависит от рекрутирования CD8(+) Т-клеток посредством активации внутриопухолевого пути STING в моделях тройного негативного рака молочной железы с дефицитом BRCA. Рак Дисков. 2019;9(6):722–37.

    ПабМед ПабМед Центральный Google ученый

  • Паркс Э.Е., Уокер С.М., Таггарт Л.Е., Маккейб Н., Найт Л.А., Уилкинсон Р. и др. Активация STING-зависимой передачи сигналов врожденного иммунитета путем повреждения ДНК, специфичного для S-фазы, при раке молочной железы. J Natl Cancer Inst.2017;109(1):66.

    Google ученый

  • Дин Л., Ким Х.Дж., Ван К., Кернс М., Цзян Т., Олсон К.Е. и др. Ингибирование PARP вызывает STING-зависимый противоопухолевый иммунитет при раке яичников с дефицитом Brca1. Cell Rep. 2018;25(11):2972–80e5.

  • Чжан С., Шан Г., Гуй С., Чжан С., Бай С.С., Чен З.Дж. Структурная основа связывания STING с TBK1 и его фосфорилирования. Природа. 2019;567(7748):394–8.

    КАС пабмед ПабМед Центральный Google ученый

  • Wu J, Sun L, Chen X, Du F, Shi H, Chen C и др.Циклический GMP-AMP является эндогенным вторичным мессенджером в передаче сигналов врожденного иммунитета цитозольной ДНК. Наука. 2013;339(6121):826–30.

    КАС пабмед Google ученый

  • Сато Х., Ниими А., Ясухара Т., Пермата ТБМ, Хагивара Й., Исоно М. и др. Путь репарации двухцепочечных разрывов ДНК регулирует экспрессию PD-L1 в раковых клетках. Нац коммун. 2017;8(1):1751.

    ПабМед ПабМед Центральный Google ученый

  • Робиллард Л., Нгуен М., Лоер А., Орсулич С., Кристелейт Р.С., Лин К. и др.Доклиническая оценка ингибитора PARP рукапариба в сочетании с ингибированием PD-1 и PD-L1 на модели рака яичников с сингенной мутацией BRCA1. AACR. 2017;6:66.

    Google ученый

  • Wang Z, Sun K, Xiao Y, Feng B, Mikule K, Ma X и др. Нирапариб активирует передачу сигналов интерферона и усиливает эффективность антител против PD-1 в моделях опухолей. Научный доклад 2019; 9 (1): 1853.

    ПабМед ПабМед Центральный Google ученый

  • Сунь Л.Л., Ян Р.Ю., Ли Ч.В., Чен М.К., Шао Б., Хсу Дж.М. и др.Ингибирование ATR подавляет PD-L1 и повышает чувствительность опухолевых клеток к опосредованному Т-клетками уничтожению. Am J Рак Res. 2018;8(7):1307–16.

    КАС пабмед ПабМед Центральный Google ученый

  • Higuchi T, Flies DB, Marjon NA, Mantia-Smaldone G, Ronner L, Gimotty PA, et al. Блокада CTLA-4 терапевтически синергизирует с ингибированием PARP при раке яичников с дефицитом BRCA1. Рак Иммунол Рез. 2015;3(11):1257–68.

    КАС пабмед ПабМед Центральный Google ученый

  • Дас Р., Верма Р., Шнол М., Боддупалли К.С., Геттингер С.Н., Клугер Х. и др.Комбинированная терапия анти-CTLA-4 и анти-PD-1 приводит к отчетливым иммунологическим изменениям in vivo. Дж Иммунол. 2015;194(3):950–9.

    КАС пабмед Google ученый

  • Shen Y, Aoyagi-Scharber M, Wang B. Захватывающая поли(АДФ-рибоза) полимераза. J Pharmacol Exp Ther. 2015;353(3):446–57.

    КАС пабмед Google ученый

  • Лео Э., Йоханнес Дж., Иллуцци Г., Чжан А., Хемсли П., Биста М.Дж. и др.Резюме LB-273: Прямое сравнение свойств пяти клинических ингибиторов PARP позволяет выявить новые данные, которые могут объяснить как наблюдаемую клиническую эффективность, так и профили безопасности. AACR. 2018;6:66.

    Google ученый

  • Венгнер А.М., Кирхгоф Д., Розе Л., Берндт С., Зимайстер Г., Крефт Б. и др. Синергическая активность ингибитора ATR BAY1895344 в сочетании с ингибиторами иммунных контрольных точек на доклинических моделях опухолей.AACR. 2019;6:66.

    Google ученый

  • Fehlings M, Simoni Y, Penny HL, Becht E, Loh CY, Gubin MM, et al. Иммунотерапия блокадой контрольных точек изменяет многомерную фенотипическую гетерогенность мышиных внутриопухолевых неоантиген-специфических CD8(+) Т-клеток. Нац коммун. 2017;8(1):562.

    КАС пабмед ПабМед Центральный Google ученый

  • Хардинг С.М., Бенчи Дж.Л., Ирианто Дж., Дишер Д.Э., Минн А.Дж., Гринберг Р.А.Митотическая прогрессия после повреждения ДНК делает возможным распознавание образов внутри микроядер. Природа. 2017; 548(7668):466–70.

    КАС пабмед ПабМед Центральный Google ученый

  • Qiu Z, Oleinick NL, Zhang J. Ингибиторы ATR/CHK1 и терапия рака. Радиотер Онкол. 2018;126(3):450–64.

    КАС пабмед Google ученый

  • Gray HJ, Bell-McGuinn K, Fleming GF, Cristea M, Xiong H, Sullivan D, et al.Фаза I комбинированного исследования ингибитора PARP велипариба, карбоплатина и гемцитабина у пациентов с распространенным раком яичников и другими солидными злокачественными новообразованиями. Гинекол Онкол. 2018;148(3):507–14.

    КАС пабмед Google ученый

  • Tian H, Gao Z, Li H, Zhang B, Wang G, Zhang Q и др. Реакция на повреждение ДНК — палка о двух концах в профилактике рака и терапии рака. Рак Летт. 2015;358(1):8–16.

    КАС пабмед Google ученый

  • Микелена Дж., Гатти М., Телони Ф., Имхоф Р., Альтмейер М.Базальная активность CHK1 обеспечивает его стабильность для поддержания внутренних функций контрольной точки S-фазы. Джей Селл Биол. 2019;218(9):2865–75.

    КАС пабмед ПабМед Центральный Google ученый

  • Брэдбери А., Холл С., Кертин Н., Дрю Ю. Использование ATR в качестве терапии рака: новая эра синтетической летальности и синергетических комбинаций? Фармакол Тер. 2020;207:107450.

    КАС пабмед Google ученый

  • Сен Т., Гей К.М., Байерс Л.А.Ориентация на репарацию повреждений ДНК при мелкоклеточном раке легкого и ландшафт биомаркеров. Transl Lung Cancer Res. 2018;7(1):50–68.

    КАС пабмед ПабМед Центральный Google ученый

  • Бевер К.М., Ле Д.Т. Дефекты репарации ДНК и последствия для иммунотерапии. Джей Клин Инвест. 2018;128(10):4236–42.

    ПабМед ПабМед Центральный Google ученый

  • Родригес М.И., Махуэлос-Мельгуизо Х., Марти Мартин-Консуэгра Х.М., Руис де Альмодовар М., Лопес-Ривас А., Хавьер Оливер Ф.Расшифровка понимания поли(АДФ-рибозилирования) в опухолевой прогрессии. Med Res Rev. 2015;35(4):678–97.

  • Wang WY, Cao YX, Zhou X, Wei B, Zhan L, Fu LT. Сайленсинг гена HMGA2 уменьшает эпителиально-мезенхимальный переход и метастазирование в лимфатические узлы при раке шейки матки за счет ингибирования сигнального пути ATR/Chk1. Am J Transl Res. 2018;10(10):3036–52.

    КАС пабмед ПабМед Центральный Google ученый

  • Галати С., Бони С., Герра М.С., Лаццаретти М., Бускини А.Аутофагия: игрок в ответ на окислительный стресс и повреждение ДНК. Оксид Мед Селл Лонгев. 2019;2019:56.

    ПабМед ПабМед Центральный Google ученый

  • Vanzo R, Bartkova J, Merchut-Maya JM, Hall A, Bouchal J, Dyrskjot L, et al. Роль(и) аутофагии в ответ на онкогены и стресс репликации ДНК. Смерть клеток 2020;27(3):1134–53.

    КАС пабмед Google ученый

  • Ji Y, Wang Q, Zhao Q, Zhao S, Li L, Sun G и др.Подавление аутофагии усиливает повреждение ДНК и гибель клеток при лечении ингибитором PARP нирапарибом плоскоклеточного рака гортани. Приложение Microbiol Biotechnol. 2019;103(23–24):9557–68.

    КАС пабмед Google ученый

  • Bellei B, Picardo M. Преждевременное старение клеток кожи человека: двойное лицо при хронических приобретенных пигментных нарушениях. Старение Res Rev. 2020; 57: 100981.

    ПабМед Google ученый

  • Флери Х., Малакин Н., Ту В., Гилберт С., Мартинес А., Оливье М.А. и др.Использование взаимосвязанных синтетических летальных взаимодействий между ингибированием PARP и обратимым старением раковых клеток. Нац коммун. 2019;10(1):2556.

    ПабМед ПабМед Центральный Google ученый

  • Бертран-Аламилло Дж., Каттан В., Шумахер М., Кодони-Серват Дж., Хименес-Капитан А., Кантеро Ф. и др. AURKB как мишень при немелкоклеточном раке легкого с приобретенной резистентностью к анти-EGFR-терапии. Нац коммун. 2019;10(1):1812.

    ПабМед ПабМед Центральный Google ученый

  • Грин А.Р., Алескандарани М.А., Али Р., Ходжсон Э.Г., Атабани С., Де Соуза К. и др.Клиническое влияние экспрессии репарации ДНК опухоли и инфильтрации Т-клеток при раке молочной железы. Рак Иммунол Рез. 2017;5(4):292–9.

    КАС пабмед Google ученый

  • Марти Х.М., Фернандес-Кортес М., Серрано-Саенс С., Замудио-Мартинес Э., Дельгадо-Беллидо Д., Гарсия-Диас А. и др. Многофакторная роль PARP-1 в микроокружении опухоли. Раки. 2020;12(3):66.

    Google ученый

  • Карзай Ф., Мадан Р.А., Оуэнс Х., Кувийон А., Ханкин А., Уильямс М. и др.Исследование фазы 2 олапариба и дурвалумаба при метастатическом кастрационно-резистентном раке предстательной железы (мКРРПЖ) в невыбранной популяции. Am Soc Clin Oncol. 2018;6:66.

    Google ученый

  • Lee JM, Cimino-Mathews A, Peer CJ, Zimmer A, Lipkowitz S, Annunziata CM, et al. Безопасность и клиническая активность дурвалумаба, ингибитора лиганда запрограммированной смерти 1, в сочетании с ингибитором поли(АДФ-рибозы) полимеразы олапарибом или ингибитором рецептора 1–3 фактора роста эндотелия сосудов седиранибом при раке у женщин: повышение дозы.Исследование фазы I J Clin Oncol. 2017;35(19):2193–202.

    КАС пабмед Google ученый

  • Томас А., Вилимас Р., Триндади С., Эрвин-Коэн Р., Ропер Н., Си Л. и др. Дурвалумаб в комбинации с олапарибом у пациентов с рецидивом МРЛ: результаты исследования II фазы. Дж. Торак Онкол. 2019;14(8):1447–57.

    КАС пабмед ПабМед Центральный Google ученый

  • Константинопулос П.А., Вагонер С.Е., Видаль Г.А., Мита М.М., Флеминг Г.Ф., Холлоуэй Р.В. и др.TOPACIO/Keynote-162 (NCT02657889): исследование фазы 1/2 нирапариба + пембролизумаба у пациентов (pts) с распространенным трижды негативным раком молочной железы или рецидивирующим раком яичников (ROC) — результаты когорты ROC. Am Soc Clin Oncol. 2018;6:66.

    Google ученый

  • Yu EY, Massard C, Retz M, Tafreshi A, Carles Galceran J, Hammerer P, et al. Keynote-365 когорта a: пембролизумаб (пембро) плюс олапариб у предварительно леченных доцетакселом пациентов (pts) с метастатическим кастрационно-резистентным раком предстательной железы (мКРРПЖ).Am Soc Clin Oncol. 2019;6:66.

    Google ученый

  • Friedlander M, Meniawy T, Markman B, Mileshkin LR, Harnett PR, Millward M, et al. Фаза 1b исследования моноклонального антитела к PD-1 BGB-A317 (A317) в сочетании с ингибитором PARP BGB-290 (290) при запущенных солидных опухолях. Am Soc Clin Oncol. 2017;6:66.

    Google ученый

  • Yap T, Krebs MG, Postel-Vinay S, Bang Y, El-Khoueiry A, Abida W, et al.Модульное исследование фазы I AZD6738, нового перорального сильнодействующего и селективного ингибитора Rad3, связанного с атаксией-телеангиэктазией (ATR), в комбинации (комбо) с карбоплатином, олапарибом или дурвалумабом у пациентов (pts) с распространенным раком. 2016;69:S2.

  • Константинопулос П., Мюнстер П., Фореро-Торез А., Холлоуэй Р., Шварцберг Л., Матулонис У. и др. Topacio: предварительная активность и безопасность у пациентов (pts) с резистентным к платине раком яичников (PROC) в исследовании фазы 1/2 нирапариба в комбинации с пембролизумабом.AACR. 2018;149:246.

    Google ученый

  • Домчек С.М., Постел-Винай С., Банг Ю.Дж., Парк Ю.Х., Александр Дж., Делорд Дж.П. и др. Резюме PD6–11: открытое многоопухолевое корзиночное исследование фазы II олапариба и дурвалумаба (MEDIOLA): результаты при зародышевом BRCA-мутированном (gBRCAm) HER2-отрицательном метастатическом раке молочной железы (MBC). AACR. 2018;6:66.

    Google ученый

  • Дрю Ю., Де Йонг М., Хонг С., Парк Ю., Вулфер А., Браун Дж. и др.Открытое комплексное исследование фазы II олапариба и дурвалумаба (MEDIOLA): результаты в отношении зародышевого BRCA-мутированного (gBRCAm) чувствительного к платине рецидивирующего рака яичников (РЯ). AACR. 2018;149:246–7.

    Google ученый

  • Cesaire M, Thariat J, Candeias SM, Stefan D, Saintigny Y, Chevalier F. Сочетание ингибирования PARP, облучения и иммунотерапии: возможная стратегия улучшения лечения рака? Int J Mol Sci. 2018;19(12):66.

    Google ученый

  • Патель П., Л. Сан, Ю. Роббинс, П. Е. Клавихо, Дж. Фридман, С. Сильвин и др. Усиление прямой цитотоксичности и ответа на блокаду иммунных контрольных точек после ионизирующего излучения с ингибированием киназы Wee1. Онкоиммунология. 2019;8(11):e1638207.

    ПабМед ПабМед Центральный Google ученый

  • Prasanna T, Wu F, Khanna KK, Yip D, Malik L, Dahlstrom JE, et al.Оптимизация ингибирования поли(АДФ-рибозо)полимеразы с помощью комбинированной эпигенетической и иммунотерапии. Онкологические науки. 2018;109(11):3383–92.

    КАС пабмед ПабМед Центральный Google ученый

  • Лайош Пустаи Х.Ш., Кристина Яу, Дениз Вульф, Энн М. Уоллес, Ребекка Шацки, Тереза ​​Хелстен, Джуди К. Буги, Туфия Хаддад, Эрика Стрингер-Ризор, Карла Фолксон, А. Джо Чиен, Рита Мухтар, Энтони Элиас, Борхес Вирджиния, Рита Нанда, Дуглас Йи, Кевин Калински, Кэти С.Альбейн, Айша Сояно Мюллер, Кэтлин Кеммер, Эми С. Кларк, Клодин Айзекс, Александра Томас, Нола Хилтон, У. Фрейзер Симманс, Джейн Перлмуттер, Мишель Мелиско, Хоуп С. Руго, Ричард Шваб, Эми Уилсон, Эми Уилсон, Руби Синграо , Смита Асаре, Лаура Дж. Вант Вир, Анджела М. ДеМишель, Ашиш Санил, Дональд А. Берри, Лаура Дж. Оценка дурвалумаба в комбинации с олапарибом и паклитакселом при HER2-негативном раке молочной железы II/III стадии высокого риска: Результаты ИСПЫТАНИЯ I-SPY 2. ААКР; 2020.

  • Farkkila A, Gulhan DC, Casado J, Jacobson CA, Nguyen H, Kochupurakkal B, et al.Иммуногеномное профилирование определяет реакцию на комбинированное ингибирование PARP и PD-1 при раке яичников. Нац коммун. 2020;11(1):1459.

    КАС пабмед ПабМед Центральный Google ученый

  • Шарма П. Биология и лечение пациентов с тройным негативным раком молочной железы. Онколог. 2016;21(9):1050–62.

    ПабМед ПабМед Центральный Google ученый

  • Сокол Э.С., Павлик Д., Хиабанян Х., Фрэмптон Г.М., Росс Дж.С., Грегг Дж.П. и др.Панраковый анализ геномных изменений BRCA1 и BRCA2 и их связи с геномной нестабильностью, измеряемой потерей гетерозиготности по всему геному. JCO Precis Oncol. 2020; 4: 442–65.

    ПабМед Google ученый

  • Shen J, Zhao W, Ju Z, Wang L, Peng Y, Labrie M, et al. PARPi запускает STING-зависимый иммунный ответ и повышает терапевтическую эффективность блокады иммунных контрольных точек независимо от BRCA. Рак рез.2019;79(2):311–9.

    КАС пабмед Google ученый

  • Sen T, Rodriguez BL, Chen L, Corte CMD, Morikawa N, Fujimoto J, et al. Нацеливание на реакцию повреждения ДНК способствует противоопухолевому иммунитету посредством STING-опосредованной активации Т-клеток при мелкоклеточном раке легкого. Рак Дисков. 2019;9(5):646–61.

    КАС пабмед ПабМед Центральный Google ученый

  • γδ Т-клетки являются эффекторами блокады иммунных контрольных точек при раке толстой кишки с дефицитом репарации несоответствия и дефектами презентации антигена оси обеспечивает длительную клиническую пользу для пациентов с раком с дефицитом репарации несоответствия ДНК (MMR-d)/микросателлитной нестабильностью (MSI-H)

    8–11 .Исключительные ответы раков MMR-d/MSI-H на ICB, вероятно, объясняются их огромным бременем предполагаемых неоантигенов, которые возникают из-за обширного накопления мутаций в их геномах 1,2 . Это согласуется с современным мнением о том, что блокада PD-1 в основном повышает эндогенный противоопухолевый иммунитет, управляемый CD8 + Т-клетками, которые распознают неоэпитопы, связанные с человеческим лейкоцитарным антигеном (HLA) класса I на раковых клетках 12–14 . Однако рак толстой кишки MMR-d часто теряет опосредованную HLA класса I антигенную презентацию из-за молчания генов HLA класса I, инактивирующих мутаций в β 2-микроглобулине (B2M) или других дефектов в аппарате процессинга антигена 3–6 , что может сделать эти опухоли устойчивыми к CD8 + Т-клеточно-опосредованному иммунитету.Интересно, что большинство β2m-дефицитных MMR-d раков продемонстрировали устойчивые ответы на блокаду PD-1 7 , предполагая, что субпопуляции иммунных клеток, отличные от CD8 + Т-клеток, способствуют этим ответам.

    Субпопуляции иммунных клеток, способные уничтожать опухоли независимо от HLA I класса, включают естественные киллеры (NK) и γδ Т-клетки. γδ Т-клетки имеют много общих характеристик со своими аналогами αβ Т-клетками, такими как цитотоксические эффекторные функции, но экспрессируют отдельный TCR, состоящий из γ и δ цепи.Различные подмножества γδ Т-клеток определяются их использованием δ-цепи TCR, из которых те, которые экспрессируют Vδ1 и Vδ3, в основном «резидентны в тканях» на участках слизистой оболочки, тогда как те, которые экспрессируют Vδ2, в основном обнаруживаются в крови 15 . Как адаптивные, так и врожденные механизмы активации, например, посредством стимуляции их γδ TCR или врожденных рецепторов, таких как NKG2D, DNAM-1, NKp30 или NKp44, были описаны для γδ Т-клеток 16 . Иммуноглобулиноподобные рецепторы клеток-киллеров (KIR) экспрессируются γδ Т-клетками и регулируют их активность в зависимости от экспрессии HLA класса I 17 .Кроме того, было обнаружено, что γδ Т-клетки экспрессируют высокие уровни PD-1 при MMR-d колоректальном раке (CRC), что указывает на то, что эти клетки могут быть нацелены на блокаду PD-1 18 .

    Здесь мы применили комбинацию подходов к транскриптомии и визуализации для углубленного анализа рака толстой кишки MMR-d, наивного и получавшего ICB, а также функциональных анализов in vitro и нашли доказательства, указывающие на то, что γδ T клетки опосредуют ответы на HLA класса I-негативные опухоли MMR-d во время терапии ICB.

    Результаты

    γδ Т-клетки обогащены

    B2M -мутантными формами рака MMR-d

    изменения, связанные с потерей генома B2M в трех группах рака MMR-d в Атласе генома рака (TCGA): аденокарцинома толстой кишки (COAD; n = 44 B2M WT , n = 6 B2M MUT ) , аденокарцинома желудка (stad; n = 48 b2m wt , n = 13 b2m mut ) и эндометрию карцинома (ucec; n = 99 b2m wt , n = 3 b2m mut ).Мы обнаружили, что B2M был одним из наиболее значительно подавленных генов в опухолях B2M MUT (двустороннее P = 8,4 × 10 -5 , частота ложных открытий с поправкой Бенджамини-Хохберга [FDR] = 0,040; рис. 1а). Гены, кодирующие компоненты аппарата презентации антигена HLA класса I, отличные от β2m, были сильно активизированы в опухолях B2M MUT (рис. 1а). Интересно, что мы обнаружили TRDV1 и TRDV3 , которые кодируют вариабельные области δ1 и δ3 цепей γδ Т-клеточного рецептора (TCR), среди наиболее значимо активируемых локусов в опухолях B2M MUT ( TRDV1). : FDR=0.0056; TRDV3 : FDR=0,0062; Рис. 1а). В соответствии с этим уровень экспрессии TCR γδ был значительно выше в B2M MUT по сравнению с B2M WT MMR-d раками (двусторонняя оценка на основе суммы рангов Уилкоксона P=1,1×10 -5). для всех объединенных когорт; рис. 1b), в то время как это было менее выражено для экспрессии αβ TCR (двусторонняя оценка на основе суммы рангов Уилкоксона P = 0,023 для всех объединенных когорт; расширенные данные, рис. 1). Кроме того, множественные KIR показали явную сверхэкспрессию в опухолях B2M MUT (фиг.1a), где уровень экспрессии всех вместе взятых KIR человека был значительно выше в опухолях B2M MUT по сравнению с опухолями B2M WT MMR-d (двусторонний анализ на основе суммы рангов Уилкоксона P=3,0×10 — 7 для всех когорт вместе взятых, рис. 1в). В совокупности эти результаты свидетельствуют о том, что рак, не подвергавшийся ICB, рак B2M MUT MMR-d демонстрирует повышенные уровни (1) Т-клеток Vδ1 и Vδ3 и (2) иммунных клеток, экспрессирующих KIRs, рецепторы, участвующие в распознавании и уничтожении HLA. клетки I класса отрицательные.

    Дополнительные данные Рис. 1. Связь мутационного статуса B2M с экспрессией рецепторов αβ Т-клеток.

    Блочная диаграмма, показывающая экспрессию РНК рецепторов αβ Т-клеток при раке MMR-p (серый), MMR-d B2MWT (розовый) и MMR-d B2MMUT (сильный удар; красный). Результаты получены для когорт TCGA COAD, STAD и UCEC и показаны для всех когорт вместе (Все) и для каждой когорты отдельно. Квадраты, усы и точки обозначают квартили, 1,5 межквартильные размахи и выбросы соответственно. P-значения были рассчитаны с помощью критерия суммы рангов Уилкоксона.*Р<0,05.

    Рисунок 1. Дефекты β2m связаны с повышенной инфильтрацией рака MMR-d γδ Т-клетками и клетками, экспрессирующими иммуноглобулин-подобный рецептор (KIR) клеток-киллеров.

    а. График вулкана, показывающий дифференциальную экспрессию генов между раковыми заболеваниями MMR-d с инактивирующими мутациями без сильного воздействия в B2M и без них. Порог значимости коэффициента ложных открытий (FDR) Бенджамини Хохберга, равный 25%, обозначен красной пунктирной линией. Результаты были получены в комбинированном анализе когорт TCGA COAD, STAD и UCEC и были скорректированы с учетом типа опухоли и мутационной нагрузки опухоли.

    б. Блочная диаграмма, показывающая экспрессию РНК γδ Т-клеточных рецепторов при раке MMR-p (серый), MMR-d B2MWT (розовый) и MMR-d B2MMUT (красный). Результаты получены для когорт TCGA COAD, STAD и UCEC и показаны для всех когорт вместе (All) и для каждой когорты отдельно. Квадраты, усы и точки обозначают квартили, 1,5 межквартильные размахи и выбросы соответственно. P-значения были рассчитаны с помощью критерия суммы рангов Уилкоксона. *Р<0,05; **Р<0,01; ***Р<0,001.

    в. То же, что (b), но для экспрессии РНК иммуноглобулиноподобных рецепторов клеток-киллеров (KIR).

    д. Тепловая карта экспрессии (Z-оценка; см. цветную полосу) наборов генов, экспрессия которых отмечает инфильтрацию определенных типов иммунных клеток при MMR-d раковых заболеваниях COAD, STAD и UCEC когорт TCGA. Раковые заболевания были ранжированы на основе иерархической группировки, как показано на дендрограммах (вверху). Две нижние полосы указывают статус мутации B2M и тип рака, как указано в легенде.P-значения и знак (+ для положительного и — для отрицательного) ассоциации экспрессии каждого набора маркерных генов со статусом мутации B2M показаны справа. P-значения были получены с помощью обычной линейной регрессии методом наименьших квадратов и скорректированы с учетом типа опухоли и мутационной нагрузки опухоли. Значимые ассоциации выделены жирным шрифтом.

    эл. Репрезентативные изображения обнаружения тканевых резидентных (CD103+), активированных (CD39+), цитотоксических (гранзим B+), пролиферирующих (Ki-67+) и PD-1+ γδ Т-клеток с помощью визуализации масс-цитометрии в ICB-наивном , рак толстой кишки MMR-d с дефектом β2m.

    ф. Частота общего количества γδ Т-клеток и CD103+ CD39+ γδ Т-клеток в ICB-наивных HLA класса I-позитивных (+) (n=4), HLA класса I-отрицательных (-)/β2m+ (n=8) и β2m– Рак толстой кишки MMR-d (n=5). Столбцы указывают медиану ± IQR. Каждая точка представляет отдельный образец. P-значения были рассчитаны с помощью теста Крускала-Уоллиса с тестом Данна для множественных сравнений. *Р<0,05.

    Затем мы оценили, была ли активация γδ TCR и KIR в опухолях B2M MUT MMR-d более высокими общими уровнями клеточной инфильтрации.С этой целью мы использовали наборы маркерных генов 19 для оценки распространенности широкого набора типов иммунных клеток на основе данных об экспрессии РНК когорт TCGA. Иерархическая кластеризация выявила кластер с высокой и низкой инфильтрацией в каждом из трех типов опухолей (рис. 1d). Помимо наборов генов γδ TCR и KIR, ни один из других наборов маркерных генов не показал повышенной экспрессии в опухолях B2M MUT по сравнению с B2M WT (рис. 1d).

    Визуализирующий масс-цитометрический анализ рака толстой кишки MMR-d с потерей HLA класса I из-за дефектов в β2m показал, что γδ Т-клетки часто демонстрируют внутриэпителиальную локализацию и экспрессию CD103 (резидентность в тканях), CD39 (активация), гранзим В (цитотоксичность) и Ki-67 (пролиферация), а также PD-1 (рис.1д). Интересно, что рак β2m показал значительно увеличенную долю CD103 + CD39 + γδ Т-клеток по сравнению с раком HLA класса I + (двусторонний P = 0,0307 по тесту Крускала-Уоллиса; рис. 1f). ). Сообщалось, что коэкспрессия CD103 и CD39 позволяет идентифицировать опухолереактивные CD8 + αβ Т-клетки при различных видах рака 20 . В целом эти данные подтверждают роль γδ Т-клеток в опосредовании естественных цитотоксических противоопухолевых ответов при HLA-классе I-негативном MMR-d раке толстой кишки.

    Цитотоксические Vδ1 и Vδ3 γδ Т-клетки инфильтрируют рак толстой кишки, вызванный MMR-d клетки, выделенные из пяти раков толстой кишки MMR-d (расширенные данные, рис. 2, расширенные данные, таблица 1). Были идентифицированы три различных подмножества Vδ (рис. 2а, расширенные данные, рис. 3), где Т-клетки Vδ1 были наиболее распространены (43% Т-клеток γδ), за которыми следовали Т-клетки Vδ2 (19%) и Vδ3 (11%). (Рисунок.2б).

    PDCD1 (кодирующий PD-1) преимущественно экспрессировался Т-клетками Vδ1 и Vδ3 γδ, в то время как клетки Vδ1 экспрессировали высокие уровни генов, кодирующих маркеры активации, такие как CD39 ( ENTPD1 ) и CD38 (рис. 2c, расширенные данные рис. 2). Кроме того, пролиферирующие γδ Т-клетки (экспрессирующие MKI67 ) особенно наблюдались в подмножествах Vδ1 и Vδ3 (рис. 2c). Другие отличительные особенности субпопуляций Т-клеток Vδ1 и Vδ3 включали экспрессию генов, кодирующих активирующие рецепторы NKp46 ( NCR1 ), NKG2C ( KLRC2 ) и NKG2D ( KLRK1 ) (рис.2с). Интересно, что экспрессия некоторых KIR также была выше в подмножествах Vδ1 и Vδ3 по сравнению с Т-клетками Vδ2 (рис. 2c). Почти все γδ Т-клетки демонстрировали экспрессию генов, кодирующих гранзим B ( GZMB ), перфорин ( PRF1 ) и гранулизин ( GNLY ) (рис. 2в).

    Расширенные данные Рис. 2. Характеристика γδ Т-клеток рака толстой кишки MMR-d с помощью секвенирования одноклеточной РНК.

    а. Стратегия гейтирования FACS для одиночных живых клеток CD45+ EpCAM– CD3+ TCRγδ+ репрезентативного образца рака толстой кишки MMR-d, показывающая последовательные гейты с процентами.

    б. Частота положительных клеток для выбранных генов в клетках Vδ1 (n = 1927), Vδ2 (n = 860) и Vδ3 (n = 506) в процентах от общего количества γδ Т-клеток из каждой опухоли толстой кишки MMR-d (n = 5) анализируют с помощью секвенирования одноклеточной РНК. Клетки Vδ3 присутствовали в двух из пяти случаев рака толстой кишки. Столбцы указывают медиану ± IQR. Каждая точка представляет отдельный образец.

    Расширенные данные Рис. 3. Отдельные кластеры γδ Т-клеток из рака толстой кишки MMR-d с помощью секвенирования одноклеточной РНК.

    а. Встраивание UMAP, показывающее γδ Т-клетки (n = 4442), выделенные из рака толстой кишки MMR-d (n = 5), проанализированные с помощью секвенирования одноклеточной РНК. Цвета представляют собой функционально разные кластеры γδ Т-клеток, идентифицированные с помощью кластеризации на основе графа и нелинейного уменьшения размеров. Каждая точка представляет одну ячейку.

    б. Встраивание UMAP (а) окрашено идентификатором пациента. Каждая точка представляет одну ячейку.

    в. Тепловая карта, показывающая нормализованное значение экспрессии генов одиночных клеток (z-показатель, шкала от фиолетового до желтого) для 10 наиболее дифференциально экспрессируемых генов в каждом идентифицированном кластере γδ Т-клеток.

    Расширенные данные Таблица 1. Характеристики клинических образцов от 17 пациентов с MMR-дефицитным раком толстой кишки.

    а. Встраивание UMAP, показывающее кластеризацию γδ Т-клеток (n = 4442), выделенных из рака толстой кишки MMR-d (n = 5), проанализированных с помощью секвенирования одноклеточной РНК. Цвета представляют использование цепи TCR Vδ. Функционально различные кластеры γδ Т-клеток показаны на рис.3. Каждая точка представляет собой одну ячейку.

    б. Частоты использования цепи Vδ TCR γδ Т-клеток (n = 4442), проанализированные с помощью секвенирования одноклеточной РНК, в процентах от общего числа γδ Т-клеток.

    в. Частота положительных клеток для выбранных генов в клетках Vδ1 (n = 1927), Vδ2 (n = 860) и Vδ3 (n = 506) в процентах от общего количества γδ Т-клеток из каждой опухоли толстой кишки MMR-d (n = 5) анализируют с помощью секвенирования одноклеточной РНК. Клетки Vδ3 присутствовали в двух из пяти случаев рака толстой кишки.Столбцы указывают медиану ± IQR. Каждая точка представляет отдельный образец.

    Рисунок 3. γδ Т-клетки рака толстой кишки MMR-d проявляют преимущественную реактивность по отношению к HLA-отрицательным раковым клеточным линиям класса I и органоидам, которая регулируется взаимодействиями лигандов NKG2D/NKG2D.

    а. Таблица, показывающая процент положительных клеток для различных цепей TCR Vδ, рецепторов врожденного иммунитета и KIR на размноженных PD-1+ и PD-1– γδ Т-клетках, отсортированных из рака толстой кишки MMR-d (n = 5), в процентах от общего γδ Т-клетки.

    б. Диаграмма, показывающая мутационный статус B2M и поверхностную экспрессию HLA класса I, лигандов NKG2D, лигандов DNAM-1 и бутирофилина на клеточных линиях CRC HCT-15, LoVo и HT-29.

    в. Гистограмма, показывающая процент CD137-позитивных γδ Т-клеток после 18-часового совместного культивирования PD-1+ и PD-1– γδ Т-клеток из рака толстой кишки MMR-d (n = 5) с HCT-15, LoVo и клетки НТ-29. Среда в качестве отрицательного контроля и РМА/иономицин в качестве положительного контроля показаны на рис.5. Столбцы показывают среднее значение ± стандартная ошибка среднего. Данные четырех (CRC94), трех (CRC167, CRC96) или двух (CRC134, CRC154) независимых экспериментов, в зависимости от наличия γδ Т-клеток.

    д. Репрезентативные изображения, показывающие уничтожение трансдуцированных NucLight Red клеток HCT-15 γδ Т-клетками (немечеными) из CRC94 в присутствии зеленого флуоресцентного реагента каспазы-3/7 в IncuCyte S3. Изображения получают сразу после добавления γδ Т-клеток (T=0) и через 12 часов после. Апоптоз раковых клеток визуализируется желтым цветом.

    эл. Гистограммы, показывающие количественную оценку уничтожения линий раковых клеток γδ Т-клетками из рака толстой кишки MMR-d (n = 5), как на (d), после 12-часового совместного культивирования. Столбцы указывают среднее значение ± SEM для двух лунок с двумя изображениями на лунку. Внизу справа репрезентативный ход апоптоза раковых клеток во времени в присутствии или отсутствии γδ Т-клеток, полученных из CRC94.

    ф. Репрезентативные графики проточной цитометрии PD-1+ γδ Т-клеток из CRC134, показывающие экспрессию IFNγ в нестимулированных условиях (отдельно) и при стимуляции двумя органоидами CRC MMR-d B2MWT и B2MKO, как указано в заголовках подграфиков.

    г. Гистограмма, показывающая экспрессию IFNγ в γδ Т-клетках рака толстой кишки MMR-d при стимуляции двумя органоидами B2MWT и B2MKO CRC MMR-d, как указано в легенде. Фоновый сигнал IFNγ каждого нестимулированного образца γδ Т-клеток вычитали из сигнала IFNγ, стимулированного опухолевыми органоидами. Для всех образцов γδ Т-клеток показаны данные для двух биологических повторов, за исключением CRC134 PD-1– (n = 1). Усы указывают на SEM.

    ч. Гистограмма, показывающая количественную оценку уничтожения линий раковых клеток γδ-Т-клетками рака толстой кишки MMR-d (n = 5) в присутствии блокирующих антител к лигандам NKG2D по сравнению с неблокированным состоянием после 12-часового совместного культивирования.Столбцы указывают среднее значение ± SEM для двух лунок с двумя изображениями на лунку.

    и. Гистограммы, демонстрирующие экспрессию IFNγ (слева) и CD107a (справа) в γδ Т-клетках при раке толстой кишки MMR-d при стимуляции B2MWT PDTO-2 (серые оттенки) или B2MKO PDTO-2 (синие оттенки), с блокированием лиганда NKG2D или без него (как указано в легенде). Для культивируемых γδ Т-клеток данные показаны для двух биологических повторов (n=2), за исключением CRC94 (n=1). Усы указывают на SEM.

    PD-1

    + γδ Т-клетки цитотоксичны по отношению к HLA класса I-негативных клеток рака толстой кишки

    Затем мы попытались определить, могут ли инфильтрирующие опухоль γδ Т-клетки распознавать и уничтожать клетки CRC.Мы выделили и размножили PD-1 и PD-1 + γδ Т-клетки (расширенные данные, рис. 4) из пяти раков толстой кишки MMR-d (расширенные данные, таблица 1). В соответствии с данными scRNA-seq расширенные Т-клетки PD-1 + γδ не содержали клеток Vδ2 + и состояли из субпопуляций Vδ1 + или Vδ3 + , тогда как фракции PD-1 содержали Vδ2 + или смесь популяций Vδ1/Vδ2/Vδ3 + (рис. 3а, расширенные данные рис. 4). Детальное иммунофенотипирование размноженных γδ Т-клеток показало, что все клетки экспрессировали активирующий рецептор NKG2D, в то время как поверхностная экспрессия KIRs была наиболее частой на PD-1 + γδ Т-клетках (Vδ1 или Vδ3 + ), в соответствии с результаты scRNA-seq нерасширенных популяций (фиг.3а, расширенные данные рис. 5).

    Расширенные данные Рис. 4. Сортировка PD-1+ и PD-1- γδ Т-клеток из рака толстой кишки MMR-d с помощью FACS и использование их цепи TCR Vδ.

    а. Стратегия гейтирования FACS для одиночных живых клеток CD3+ TCRγδ+ репрезентативного образца рака толстой кишки MMR-d, показывающая последовательные гейты с процентами.

    б. Сортировка всех γδ Т-клеток из CRC94 (из-за малого количества клеток PD-1+), а также PD-1– (синие квадраты) и PD-1+ (оранжевые квадраты) γδ Т-клеток из CRC167, CRC134, CRC96 и CRC154.Каждая точка — это отдельная ячейка.

    в. Использование цепи TCR Vδ после размножения γδ Т-клеток из CRC94 и CRC167. Каждая точка — это отдельная ячейка.

    д. Использование цепи TCR Vδ во время сортировки (левая панель), а также после размножения γδ Т-клеток из CRC134, CRC96 и CRC154 (правая панель). Из CRC154 Т-клетки PD-1-γδ не размножались в культуре. Каждая точка — это отдельная ячейка.

    эл. Таблица, показывающая количество γδ Т-клеток, выделенных из рака толстой кишки во время сортировки по сравнению с 3-4 неделями после размножения, и их кратное увеличение.

    Дополнительные данные Рис. 5. Реактивность γδ Т-клеток рака толстой кишки MMR-d по отношению к линиям раковых клеток.

    а. Таблица, показывающая процент положительных клеток для различных цепей Vδ TCR (как на рис. 3a), тканевых маркеров резидентности/активации, цитотоксических молекул, молекул иммунных контрольных точек, рецепторов цитокинов и рецепторов Fc на расширенных PD-1+ и PD- 1– γδ Т-клетки от рака толстой кишки MMR-d (n = 5) в процентах от общего количества γδ Т-клеток.

    б. Тепловая карта, показывающая мутационный статус B2M и поверхностную экспрессию HLA класса I, лигандов NKG2D, лигандов DNAM-1 и бутирофилина на клетках SW403, SK-CO-1, K-562 и Дауди.

    в. Гистограмма, показывающая процент CD137-позитивных γδ Т-клеток после 18-часового совместного культивирования PD-1+ и PD-1– γδ Т-клеток из рака толстой кишки MMR-d (n = 5) с SW403, SK-CO-1 , К-562 и ячейки Дауди. Среду использовали в качестве отрицательного контроля, а РМА/иономицин — в качестве положительного контроля. Столбцы указывают среднее значение ± стандартная ошибка среднего. Данные двух независимых экспериментов (CRC94, CRC134, CRC154, CRC96) в зависимости от наличия γδ Т-клеток.

    Рисунок 4. Блокада иммунных контрольных точек (ICB) вызывает глубокую инфильтрацию γδ Т-клеток в рак толстой кишки MMR-d с дефектами презентации антигена.

    а. Вулканический график, показывающий дифференциальную экспрессию генов РНК между раками MMR-d до и после ICB в исследовании NICHE. Порог значимости FDR Бенджамини Хохберга, равный 25%, обозначен красной пунктирной линией.

    б. То же, что (а), но ограничено пятью видами рака MMR-d в исследовании NICHE с высокоэффективными (инактивирующими) мутациями в B2M.

    в. Блочная диаграмма, показывающая экспрессию РНК до (серый) и после ICB (синий) вариабельных областей рецептора δ Т-клеток при раке MMR-d в исследовании NICHE с сильными (инактивирующими) мутациями в B2M.Квадраты, усы и точки обозначают квартили, 1,5 межквартильные размахи и выбросы соответственно. P-значения были рассчитаны с помощью критерия суммы рангов Уилкоксона.

    д. То же, что и (c), но для Ig-подобных рецепторов клеток-киллеров (KIR; post-ICB выделены оранжевым цветом).

    эл. Блочная диаграмма, показывающая экспрессию РНК рецепторов γδ Т-клеток и Ig-подобных рецепторов клеток-киллеров до и после ICB для рака MMR-d с сильными мутациями B2M и без них (как указано ниже по оси x). P-значения были для взаимодействия B2M_status:лечение в обычной модели линейной регрессии методом наименьших квадратов.Значимые значения p указывают на то, что индуцированное лечением увеличение экспрессии γδ TCR/KIR более выражено при опухолях B2MMUT по сравнению с B2MWT. Квадраты, усы и точки обозначают квартили, 1,5 межквартильные размахи и выбросы соответственно.

    ф. Частота различных популяций иммунных клеток при B2MWT (HLA-класс I-положительный, n=5) и B2MMUT (HLA-класс I-отрицательный, n=5) раке толстой кишки MMR-d при лечении ICB. Столбцы указывают медиану ± IQR. Каждая точка представляет отдельный образец.P-значения рассчитывали по критерию Манна-Уитни. **Р<0,01 г. Репрезентативные изображения обнаружения тканевых резидентов (CD103+), пролиферирующих (Ki-67+), активированных (CD39+), цитотоксических (GZMB+) и γδ Т-клеток с помощью визуализации масс-цитометрии при раке толстой кишки B2MMUT MMR-d при ICB лечение.

    ч. Репрезентативное изображение, показывающее взаимодействие между γδ Т-клетками (окрашены красным) и опухолевыми клетками каспазы-3+ (окрашены голубым) с помощью масс-цитометрии с визуализацией в опухоли толстой кишки B2MMUT MMR-d после лечения ICB.

    Мы измерили реактивность расширенных популяций γδ Т-клеток по отношению к HLA-классу I-отрицательных и HLA-класса I-позитивных раковых клеточных линий (рис. 3b, расширенные данные, рис. 5). При совместном культивировании с различными линиями раковых клеток экспрессия маркеров активации и секреция IFNγ в основном индуцировались в PD-1 + γδ Т-клетках (Vδ1 или Vδ3 + ), а клеточная реактивность была наиболее выражена против HLA класса I-отрицательных. клеточные линии (рис. 3c, расширенные данные, рис. 5–6). Реактивность субпопуляций PD-1 (обогащенных Vδ2 + ) по отношению к клеточным линиям колоректального рака не обнаружена (рис.3c, расширенные данные, рис. 5–6). Чтобы количественно оценить и визуализировать различия в уничтожении клеточных линий CRC с помощью PD-1 + и PD-1 γδ T-клеток, мы совместно культивировали γδ T-клеточные популяции с тремя клеточными линиями CRC (HCT-15, LoVo , HT-29), трансдуцированный флуоресцентным реагентом каспазы-3/7, для измерения апоптоза раковых клеток с течением времени (рис. 3d-e). Это показало выраженный апоптоз раковых клеток при совместном культивировании с PD-1 + γδ Т-клетками (Vδ1 или Vδ3 + ) по сравнению с клетками PD-1 , с самым высоким уровнем уничтожения HLA класса I-негативных HCT-15. клетки (рис.3е, Фильм 1-2).

    Дополнительные данные Рис. 6. Поверхностная экспрессия маркеров активации и секреция IFNγ при совместном культивировании γδ Т-клеток из рака толстой кишки MMR-d с линиями раковых клеток.

    а. Графики проточной цитометрии, показывающие экспрессию CD137 на PD-1+ γδ Т-клетках после 18-часового совместного культивирования с клетками HCT-15, LoVo, HT-29, K-562 и Daudi по сравнению только со средой. Гейтс указывает процент положительных γδ Т-клеток.

    б. Гистограммы, показывающие присутствие IFNγ в супернатанте после 18-часового совместного культивирования PD-1+ γδ Т-клеток с линиями раковых клеток.Включены среда в качестве отрицательного контроля и РМА/иономицин в качестве положительного контроля. Столбцы указывают среднее значение ± SEM для трех повторов.

    в. Гистограммы, показывающие процент OX40-позитивных γδ Т-клеток после 18-часового совместного культивирования PD-1+ и PD-1– γδ Т-клеток из рака толстой кишки MMR-d (n = 5) с HCT-15, LoVo и клетки НТ-29. Столбцы указывают среднее значение ± стандартная ошибка среднего. Данные четырех (CRC94), трех (CRC167, CRC96) или двух (CRC134, CRC154) независимых экспериментов, в зависимости от наличия γδ Т-клеток.

    д. Гистограммы, показывающие экспрессию PD-1 на γδ Т-клетках в виде отличия от исходного (среднего) состояния после 18-часового совместного культивирования PD-1+ и PD-1– γδ Т-клеток из рака толстой кишки MMR-d (n = 5 ) с ячейками HCT-15, LoVo и HT-29.

    Затем мы установили две исходные от родителей линии опухолевых органоидов (PDTO; таблица расширенных данных 2) MMR-d CRC и создали изогенные линии B2M KO с использованием CRISPR. Геномный нокаут B2M эффективно устранял экспрессию HLA класса I на клеточной поверхности (расширенные данные, рис.7). Мы подвергли две линии B2M KO и их родительские линии B2M WT расширенным подмножествам γδ Т-клеток и количественно оценили активацию γδ Т-клеток путем определения экспрессии IFNγ. Подобно нашим данным клеточной линии, γδ Т-клетки проявляли повышенную реактивность по отношению к B2M KO PDTO по сравнению с B2M WT PDTO (рис. 3f-g). Кроме того, реактивность γδ Т-клеток по отношению к опухолевым органоидам B2M KO преимущественно содержалась в популяции PD-1 + γδ Т-клеток (фиг.3г). Таким образом, отсутствие презентации антигена HLA класса I в опухолевых клетках MMR-d может эффективно ощущаться γδ Т-клетками и стимулировать их противоопухолевый ответ.

    Расширенные данные Рис. 7. Характеристика опухолевых органоидов и результаты анализа реактивности.

    а. Стратегия гейтирования проточной цитометрией клеток PDTO для анализа поверхностного окрашивания. Выбранные клетки гейтировали по отдельным живым клеткам перед количественной оценкой сигнала окрашивания.

    б. Представление гистограммы и подсчет поверхностного окрашивания экспрессии MHC-I, PD-L1 и β2m на двух линиях PDTO B2MWT и B2MKO после предварительной стимуляции IFNγ.Окрашивание изотипическими антителами для каждого флуорохрома (PE, APC и FITC) было включено в качестве отрицательного контроля.

    в. Стратегия гейтирования проточной цитометрией образцов γδ Т-клеток для анализа внутриклеточного окрашивания для проверки противоопухолевой реактивности при стимуляции PDTO. Популяцию лимфоцитов далее гейтировали по отдельным клеткам, живым клеткам и клеткам CD3+, клеткам γδ TCR+ и CD8+, а также клеткам CD8–CD4–. Реактивность образца основывалась на IFNγ+ клетках выбранной популяции.

    д. Представление гистограммы и подсчет поверхностного окрашивания лигандов NKG2D MICA/B, ULBP1, ULBP2/5/6, ULBP3 и ULBP4 на двух линиях PDTO B2MWT и B2MKO после предварительной стимуляции IFNγ.

    эл. Стратегия гейтирования проточной цитометрией образцов γδ Т-клеток для анализа внутриклеточного окрашивания после стимуляции PDTO в присутствии блокирующего лиганда NKG2D. Популяцию лимфоцитов далее гейтировали по отдельным клеткам, живым клеткам и клеткам CD3+, за которыми следовали клетки γδ TCR+ и CD8+, а также клетки CD8–.Реактивность конечной популяции основывалась на клетках IFNγ+ или CD107a+.

    Расширенные данные. Таблица 2. Характеристики органоидов, полученных от пациентов при колоректальном раке с дефицитом MMR.

    Экспрессия NKG2D на γδ Т-клетках снижалась во время совместного культивирования с клетками-мишенями (расширенные данные, рис. 8), что указывает на участие рецептора NKG2D в активности γδ Т-клеток. Лиганды NKG2D MICA/B и ULBP экспрессировались линиями раковых клеток (рис. 3b) и MMR-d CRC PDTO, независимо от их статуса B2M (расширенные данные, рис.7). Чтобы выяснить, какие взаимодействия рецептор-лиганд могут регулировать активность PD-1 + γδ Т-клеток, мы провели эксперименты по блокированию, сфокусированные на (i) NKG2D, (ii) DNAM-1 и (iii) передаче сигналов γδ TCR. Из этих кандидатов единственный последовательный ингибирующий эффект наблюдался для блокирования лиганда NKG2D на раковых клетках, что снижало активацию и убивающую способность большинства PD-1 + γδ Т-клеток (рис. 3h, расширенные данные, рис. 9–10). , подтверждая механистическое участие рецептора NKG2D в активации γδ Т-клеток в этом контексте.Кроме того, блокирование лигандов NKG2D на MMR-d CRC PDTO снижало направленную на PDTO опухолевую реактивность γδ Т-клеток из CRC94 и CRC134 (рис. 3i). Вместе эти результаты показывают, что реактивность γδ Т-клеток в отношении опухолей MMR-d частично зависит от взаимодействия NKG2D/NKG2D-лиганд.

    Расширенные данные Рис. 8. Поверхностная экспрессия активирующего рецептора NKG2D PD-1+ γδ Т-клетками из рака толстой кишки MMR-d при совместном культивировании с линиями раковых клеток.

    а. Гистограммы, показывающие экспрессию NKG2D на PD-1+ γδ Т-клетках от рака толстой кишки MMR-d (n = 5) после 18-часового совместного культивирования PD-1+ γδ Т-клеток с линиями раковых клеток.Включены среда в качестве отрицательного контроля и РМА/иономицин в качестве положительного контроля. Столбцы указывают среднее значение ± стандартная ошибка среднего. Данные четырех (CRC94), трех (CRC167, CRC96) или двух (CRC134, CRC154) независимых экспериментов, в зависимости от наличия γδ Т-клеток.

    б. Графики проточной цитометрии, показывающие экспрессию NKG2D на PD-1+ γδ Т-клетках после 18-часового совместного культивирования с клетками HCT-15, LoVo, HT-29, K-562 и Daudi по сравнению только со средой. Гейтс указывает процент положительных γδ Т-клеток.

    Расширенные данные Рис.9. Уничтожение линий раковых клеток PD-1+ γδ Т-клетками из рака толстой кишки MMR-d в присутствии лиганда NKG2D, DNAM-1 или блокирования γδ TCR.

    а. Гистограмма, показывающая количественную оценку уничтожения клеток HT-29 γδ Т-клетками из рака толстой кишки MMR-d (n = 5) в присутствии блокирующих антител к лигандам NKG2D по сравнению с неблокированным состоянием после 12-часового совместного культивирования. Столбцы указывают среднее значение ± SEM для двух лунок с двумя изображениями на лунку.

    б. Гистограмма, показывающая количественную оценку уничтожения клеток HCT-15 γδ Т-клетками рака толстой кишки MMR-d (n = 5) в присутствии антител, блокирующих DNAM-1 или γδ TCR, по сравнению с неблокированным состоянием через 12 часов ко- культура.Столбцы указывают среднее значение ± SEM для двух лунок с двумя изображениями на лунку.

    в. То же, что и (б), но для ячеек LoVo.

    д. То же, что и (б), но для клеток HT-29.

    Дополнительные данные Рис. 10. Реактивность PD-1+ γδ Т-клеток в отношении линий раковых клеток от рака толстой кишки MMR-d в присутствии антител, блокирующих лиганд NKG2D.

    а. Гистограмма, показывающая процент CD137-позитивных γδ Т-клеток после 18-часового совместного культивирования PD-1+ γδ Т-клеток из рака толстой кишки MMR-d (n = 5) с клетками HCT-15, LoVo и HT-29 в наличие блокирующих антител к лигандам NKG2D.Линиями показаны аналогичные эксперименты. Данные двух независимых экспериментов.

    б. Гистограмма, показывающая процент OX40-позитивных γδ Т-клеток после 18-часового совместного культивирования PD-1+ γδ Т-клеток из рака толстой кишки MMR-d (n = 5) с клетками HCT-15, LoVo и HT-29 в наличие блокирующих антител к лигандам NKG2D. Линиями показаны аналогичные эксперименты. Данные двух независимых экспериментов.

    в. Гистограммы, показывающие экспрессию PD-1 на γδ Т-клетках в виде отличия от исходного (среднего) состояния после 18-часового совместного культивирования PD-1+ γδ Т-клеток из рака толстой кишки MMR-d (n = 5) с HCT-15 , LoVo и HT-29 в присутствии блокирующих антител к лигандам NKG2D.Линиями показаны аналогичные эксперименты.

    Активированные

    γ δ инфильтрация Т-клеток, обработанные ICB B2M — мутантный MMR-d рак толстой кишки

    Затем мы изучили, как ICB влияет на инфильтрацию и активацию γδ Т-клеток при MMR-d раке толстой кишки в терапевтическом контексте. С этой целью мы проанализировали образцы до и после лечения в исследовании NICHE 11 , в котором пациентов с раком толстой кишки лечили неоадъювантной блокадой PD-1 плюс CTLA-4. При раке толстой кишки MMR-d (n = 38) гены, кодирующие TCR γδ, сильно активировались в ответ на ICB (рис.4а). Сосредоточившись на пяти раковых заболеваниях B2M MUT , мы обнаружили, что экспрессия генов, кодирующих TCR γδ, также сильно индуцировалась при ICB, с неизменно большими размерами эффекта по сравнению с раком B2M WT (рис. 4b). . Из вариабельных областей δ экспрессия TRDV1 (Vδ1) наиболее сильно индуцировалась при ICB в опухолях B2M MUT (рис. 4c). Экспрессия KIR также повышалась при лечении ICB как в когорте в целом, так и в подгруппе рака B2M MUT (рис.4а-б). Набор KIRs с повышенной экспрессией при ICB в B2M MUT раковых заболеваниях (рис. 4d) согласовывался с наборами KIRs с повышенной экспрессией в B2M MUT MMR-d опухолях в TCGA (рис. 1a), а те, которые экспрессировались с помощью MMR-d инфильтрирующих опухоль γδ Т-клеток (рис. 2c). Наконец, экспрессия наборов генов γδ TCR и KIR более сильно индуцировалась при ответе на ICB в B2M MUT по сравнению с B2M WT (γδ TCR: двустороннее взаимодействие P = 0.0056; КИР: двустороннее взаимодействие P=0,047 (рис. 4e).

    Для количественной оценки и исследования различий в фенотипе γδ Т-клеток после лечения ИКБ мы применяли визуализирующую масс-цитометрию для определения профиля инфильтрации иммунных клеток в тканях после ИКБ, полученных из пяти B2M MUT HLA класса I-отрицательных и пяти B2M WT HLA-положительный рак I класса. Из-за основных патологических клинических ответов остаточные раковые клетки отсутствовали в большинстве образцов после лечения ICB.Во всех тканях была обнаружена глубокая инфильтрация различных типов иммунных клеток, из которых инфильтрация γδ Т-клеток была значительно увеличена в обработанных ICB B2M MUT по сравнению с B2M WT MMR-d раком толстой кишки (двусторонний P=0,0079 по критерию Манна-Уитни, рис. 4f, расширенные данные, рис. 11). В единственном случае B2M MUT , который содержал раковые клетки, γδ Т-клетки демонстрировали коэкспрессию CD103, Ki-67, CD39, гранзима B и PD-1 (рис. 4g).Кроме того, мы наблюдали, что γδ Т-клетки напрямую взаимодействовали с каспазой-3 + апоптотических раковых клеток в этой опухоли (рис. 4h). Взятые вместе, эти результаты показывают, что лечение ICB рака толстой кишки MMR-d значительно увеличивает внутриопухолевое присутствие активированных, цитотоксических и пролиферирующих γδ T-клеток, особенно когда эти виды рака являются β2m-дефицитными, указывая на то, что γδ T клетки являются эффекторами лечения ICB в пределах этот контекст.

    Расширенные данные Рис. 11. Распределение популяций иммунных клеток при В2М-диком типе и В2М-мутантном раке толстой кишки при блокаде иммунных контрольных точек (ICB) с помощью масс-цитометрии.

    Тепловая карта, показывающая количество клеток (клеток/мм2) различных фенотипов иммунных клеток по данным масс-цитометрического обнаружения B2MWT (HLA-класс I-положительный, n=5) и B2MMUT (HLA-класс I-отрицательный, n=5) MMR-d рак толстой кишки после лечения ICB. Иерархическая кластеризация была выполнена на образцах внутри двух групп. Цветная полоса масштабируется по основным иммунным линиям.

    Обсуждение

    CD8 + αβ Т-клетки являются основными эффекторами ICB 13,14,21 , но клинически значимые ответы, наблюдаемые при раке MMR-d с дефектами HLA класса I, предполагают участие других иммунных эффекторных клеток .Здесь мы показываем, что геномная инактивация B2M при раке толстой кишки MMR-d была связана с: (i) повышенной частотой активированных γδ T-клеток в опухолях без ICB, (ii) повышенным присутствием инфильтрирующих опухоль γδ T клеток при обработке ICB, (iii) in vitro активация инфильтрирующих опухоль γδ Т-клеток клеточными линиями колоректального рака и PDTO, и iv) уничтожение этих опухолевых клеток γδ Т-клетками, в частности, субпопуляциями Vδ1 и Vδ3, экспрессирующими PD -1.

    Различные подмножества γδ Т-клеток проявляют удивительно разнообразные функции, которые в контексте рака варьируются от стимулирования роста опухоли до тумороцидного действия. 22,23 Следовательно, представляет интерес, что определяет противоопухолевую реактивность γδ Т-клеток. Наши данные свидетельствуют о том, что Т-клетки Vδ1 и Vδ3, особенно проникающие в опухоль, могут распознавать и убивать HLA класса I-негативные опухоли MMR-d, тогда как клетки Vγ9Vδ2, наиболее изученная и основная подгруппа γδ Т-клеток в крови, по-видимому, менее важны. в этом контексте. Это согласуется с другими исследованиями, показывающими, что цитотоксическая способность клеток Vδ1 обычно превосходит их аналоги Vδ2 24–28 .Следует отметить, что о цитотоксичности инфильтрирующих опухоль клеток Vδ3, насколько нам известно, ранее не сообщалось. Кроме того, наблюдение, что PD-1 + γδ Т-клетки продемонстрировали явно более высокие уровни противоопухолевой реактивности по сравнению с их аналогами PD-1 , предполагает, что, как и для CD8 + αβ Т-клетки 29 , PD- 1 экспрессия может быть маркером противоопухолевой реактивности в γδ Т-клетках.

    Известно, что механизмы активации γδ Т-клеток сложны и разнообразны 16 .В частности, для клеток Vδ1 + было описано, что NKG2D участвует в распознавании опухолей, что зависит от экспрессии опухолевыми клетками лигандов NKG2D MICA/B и ULBPs 30,31 . В нашем исследовании MICA/B и ULBP были высоко экспрессированы клеточными линиями MMR-d CRC и опухолевыми органоидами, и блокирование этих лигандов снижало активацию γδ Т-клеток и цитотоксичность. Это предполагает роль рецептора активации NKG2D в реактивности γδ Т-клеток по отношению к HLA класса I-негативных опухолей MMR-d.Кроме того, мы обнаружили экспрессию KIR в первую очередь на PD-1 + γδ Т-клетках (подмножества Vδ1 или Vδ3 + ), чья противоопухолевая реактивность и уничтожение были явно усилены, когда в опухолевых клетках отсутствовал HLA класса I.

    Наши результаты широкое значение для иммунотерапии рака. Во-первых, наши результаты показывают, что рак MMR-d и другие опухоли с дефектами HLA класса I могут быть особенно привлекательными мишенями для клеточной терапии на основе Vδ1 или Vδ3 γδ T-клеток. Во-вторых, наши результаты обеспечивают основу для новых (комбинаторных) иммунотерапевтических подходов для дальнейшего усиления противоопухолевого иммунитета на основе γδ-Т-клеток.В-третьих, наличие или отсутствие в опухолях специфических субпопуляций γδ-Т-клеток (например, Vδ1 или Vδ3) может помочь определить пациентов (не)чувствительных к ICB, особенно в случае рака MMR-d и других злокачественных новообразований с частыми дефектами HLA класса I. , такие как аденокарцинома желудка 32 и лимфома Ходжкина 33 .

    Несмотря на то, что мы предоставили подробный и многомерный анализ, наше исследование относительно небольшое, и можно предположить, что γδ Т-клетки не являются единственным фактором, определяющим ответы ICB в HLA класса I-негативных MMR-d CRC опухолях.В этом контексте другие независимые от HLA класса I иммунные субпопуляции, такие как врожденные лимфоидные клетки (ILC), (неоантиген-специфические) CD4 + Т-клетки (как сообщалось в мышиных моделях рака MMR-d 34 ) и макрофаги могут также внести свой вклад. Кроме того, необходимо уточнить потребности других типов иммунных клеток в оказании помощи эффекторным функциям γδ Т-клеток.

    В заключение, наши результаты дают убедительные доказательства того, что γδ Т-клетки являются цитотоксическими эффекторными клетками при лечении ICB при HLA-классе I-негативном MMR-d раке толстой кишки, что имеет значение для дальнейшего использования γδ Т-клеток в иммунотерапии рака.

    Методы

    Данные TCGA

    Данные экспрессии РНК (необработанные данные и количество фрагментов на килобазу транскрипта на миллион картированных прочтений, верхний квартиль FPKM-UQ) аденокарциномы толстой кишки (COAD), аденокарциномы желудка (STAD) и карциномы эндометрия тела матки ( UCEC) когорты исследовательской сети The Cancer Genome Atlas (TCGA) Research Network были загружены через портал данных GDC (https://portal.gdc.cancer.gov) 10 апреля -го года 2019 года. Проект PanCanAtlas был загружен с сайта Synapse (syn7824274) 18 сентября -го -го года 2017 года.Эти вызовы мутаций были сгенерированы в стандартизированном конвейере для всех образцов, что привело к единому набору данных. Статус дефекта несоответствия репарации был получен от Thorsson et al. 35 (подтип TCGA = GI.HM-indel или UCEC.MSI).

    Данные секвенирования исследования NICHE

    Необработанные считывания РНК (файлы FASTA) нашего недавно опубликованного исследования NICHE 10 (ClinicalTrials.gov: NCT03026140) были созданы, как описано в исходной публикации, и сопоставлены с эталонным геномом человека (GRCh48) с помощью Программное обеспечение STAR 36 , версия 2.7.7а, используя настройки по умолчанию. Для количественной оценки экспрессии генов мы использовали файл аннотаций gencode.v35.annotation.gtf. Данные о соматических мутациях были получены в результате секвенирования ДНК биоптатов опухолей до лечения и сопоставления ДНК зародышевой линии, как описано в оригинальной публикации 10 .

    Анализ дифференциальной экспрессии

    Дифференциальную экспрессию РНК генов тестировали в R с использованием EdgeR 37 , Limma 38 и Voom 39 . Необработанные числа прочтений были отфильтрованы путем удаления генов с низкой экспрессией.Коэффициенты нормализации были рассчитаны с помощью EdgeR, чтобы преобразовать необработанные значения в журнал 2 значений на миллион чтений (CPM) и рассчитать остатки с помощью Voom. Затем Voom использовали для подгонки сглаженной кривой к √(остаточному стандартному отклонению) средней экспрессии генов, которую затем строили для визуального контроля, чтобы подтвердить, что соответствующий порог использовался для фильтрации низкоэкспрессируемых генов (определяемых как минимальное количество фильтрация, необходимая для преодоления падающего тренда средней дисперсии при малых количествах).Затем Limma использовали для расчета дифференциальной экспрессии генов на основе подбора линейной модели с учетом сглаженной кривой для весов выборки и эмпирического байесовского сглаживания стандартных ошибок. Частота ложных открытий (FDR) была рассчитана с помощью поправки Бенджамини-Хохберга к полученным p-значениям.

    Данные TCGA

    Используя данные TCGA, мы рассчитали дифференциальную экспрессию между опухолями с сильными мутациями B2M и без них, с поправкой на тип опухоли и мутационную нагрузку опухоли (TMB), используя следующую формулу расчета: выражение ∼ Primary_Site + TMB + B2M_status (+ перехват по умолчанию), для которого Primary_Site был трехуровневым фактором (COAD, STAD или UCEC), TMB был непрерывной переменной (log 10 [количество мутаций в масштабе экзома]), а B2M_status был двухуровневым. выровненный фактор (мутированный или дикий тип).

    Данные исследования NICHE

    Используя данные исследования NICHE, мы рассчитали дифференциальную экспрессию между лечением до и после ICB. Чтобы учесть парный характер этих данных, мы использовали следующую формулу дизайна: выражение ∼ Пациент + ICB (+ точка пересечения по умолчанию), для которой Пациент был фактором для каждого отдельного пациента, а ICB был двухуровневым фактором (ICB -лечили да/нет).

    Анализ экспрессии набора генов иммунных маркеров

    Данные TCGA

    Чтобы использовать данные секвенирования РНК для получения относительной оценки инфильтрации конкретных типов иммунных клеток в опухолях TCGA, мы суммировали log 2 (FPKM- UQ+1) экспрессия генов, которые специфически экспрессируются в представляющих интерес типах иммунных клеток.С этой целью мы использовали наборы маркерных генов, опубликованные Danaher et al. 19 , и расширили его за счет (i) маркерных генов Т-клеток CD4 Davoli et al. 40 , (ii) набор генов γδT-клеточного рецептора (состоит из всех генов, названия которых начинаются с «TRDC», «TRGC», «TRDV», «TRGV», «TRDJ», «TRGJ»), и (iii ) набор генов Ig-подобного рецептора клеток-киллеров (KIR) (состоящий из всех генов, название которых начинается с «KIR» и чье название содержит «DL» или «DS». Мы исключили набор генов «NK CD56dim клетки» Danaher et al. .(включая IL21R, KIR2DL3, KIR3DL1 и KIR3DL2) из ​​нашего анализа, поскольку три из четырех генов в этом наборе были KIR, и, следовательно, этот набор показал высокую коллинеарность / избыточность по отношению к нашему полному набору генов KIR. Значения экспрессии, специфичные для набора генов, были преобразованы по Z-оценке. Для основанного на TCGA анализа опухолей MMR-d связь экспрессии набора маркерных генов со статусом мутации B2M (высокоэффективная мутация да/нет) рассчитывали с использованием обычной линейной регрессии методом наименьших квадратов, реализованной в пакете Python Statsmodels (https:// пипи.org/project/statsmodels/), с поправкой на тип опухоли и TMB, как описано выше для анализа дифференциальной экспрессии TCGA.

    Данные исследования NICHE

    На основе данных исследования NICHE мы проверили, индуцируется ли более сильно экспрессия набора генов рецептора γδT-клеток и набора генов Ig-подобного рецептора клеток-киллеров (KIR) при лечении ICB в B2M MUT опухолей MMR-d по сравнению с опухолями B2M WT MMR-d. Во-первых, мы суммировали log 2 (прочтений на миллион + 1) экспрессии генов в двух соответствующих наборах генов для каждого образца.Затем мы подобрали обычную модель линейной регрессии методом наименьших квадратов (Statsmodels, см. выше), учитывающую парный характер данных, используя следующую формулу расчета: фактор для каждого отдельного пациента, ICB был двухуровневым фактором (лечение ICB да/нет), B2M был двухуровневым фактором ( B2M MUT / B2M WT ), и ICB: B2M был интерактивным термином между ICB и B2M , который представляет собой интересующую статистику (значительно различается ли основанная на ICB индукция экспрессии двух наборов генов между B2M MUT и B2M WT пациентов).

    Иерархическая кластеризация

    Иерархическая кластеризация профилей экспрессии наборов иммунных маркеров (Z-баллы) когорт TCGA была выполнена с использованием пакета Python Scipy 41 с евклидовым расстоянием в качестве метрики расстояния и с использованием алгоритма минимизации дисперсии Уорда.

    Образцы пациентов

    Ткани первичного рака толстой кишки были взяты у 17 пациентов с раком толстой кишки, перенесших хирургическую резекцию опухоли в Медицинском центре Лейденского университета (LUMC, Нидерланды) (таблица расширенных данных 1).Ни один пациент с предшествующим анамнезом воспалительного заболевания кишечника не был включен. Это исследование было одобрено Комитетом по медицинской этике Медицинского центра Лейденского университета (протокол P15.282), и пациенты дали письменное информированное согласие. Кроме того, для этого исследования использовались ткани первичного рака толстой кишки от 10 пациентов с раком толстой кишки, включенных в исследование NICHE (NCT03026140) 10 , проведенное в Институте рака Нидерландов (NKI, Нидерланды). Все образцы были анонимизированы, и с ними обращались в соответствии с этическими принципами, описанными в Кодексе надлежащего вторичного использования тканей человека в Нидерландах Голландской федерации медицинских научных обществ.

    Обработка тканей колоректального рака

    Подробности обработки тканей колоректального рака описаны ранее 18 . Короче говоря, был выполнен макроскопический срез от просвета до наиболее инвазивной области опухоли. Ткани собирали в среде IMDM+Glutamax (Gibco), дополненной 20% фетальной телячьей сывороткой (FCS) (Sigma-Aldrich), 1% пенициллина/стрептококка (Gibco) и фунгизоном (Gibco) и 0,1% ципрофлоксацина (предоставляется аптекой LUMC). ) и гентамицин (Invitrogen), и сразу нарезать на мелкие фрагменты в чашке Петри.Ферментативное расщепление проводили с использованием 1 мг/мл коллагеназы D (Roche Diagnostics) и 50 мкг/мл ДНКазы I (Roche Diagnostics) в 5 мл среды IMDM+Glutamax в течение 30 мин при 37°C в пробирках GenMACS C (Miltenyi Biotec). Во время и после инкубации клеточные суспензии механически диссоциировали на диссоциаторе softMACS (Miltenyi Biotec). Суспензии клеток фильтровали через сито для клеток 70 мкм (Corning), промывали в среде IMDM+Glutamax с 20% FCS, 1% пенициллина/стрептомицина и 0,1% фунгизона, а количество клеток и их жизнеспособность определяли с помощью Muse Count & Viability. Комплект (Merck) на анализаторе клеток Muse (Merck).Основываясь на количестве жизнеспособных клеток, клетки в среде IMDM+Glutamax подвергали криоконсервации в жидком азоте до тех пор, пока время анализа не дополнялось 1:1 80% FCS и 20% диметилсульфоксидом (ДМСО) (Merck).

    Иммуногистохимическое определение белков MMR, β2m и HLA класса I

    Статус MMR опухоли определяли иммуногистохимическим определением PMS2 (антитела к PMS2; клон EP51, DAKO) и MSH6 (антитела к MSH6; клон EPR3945, Abcam) белки 42 . Дефицит MMR определяли как отсутствие экспрессии по крайней мере одного из белков MMR в присутствии внутреннего положительного контроля.Статус β2m опухоли определяли иммуногистохимическим обнаружением β2m (антитела против β2m; клон EP2978Y, Abcam). Иммуногистохимическое определение экспрессии HLA класса I в опухолях проводили с использованием моноклональных антител HCA2 и HC10 (Nordic-MUbio) и классифицировали как положительные, слабые или утраченные HLA класса I, как описано ранее 6 .

    Визуализирующая масс-цитометрия, окрашивание и анализ

    Визуализирующая масс-цитометрия (IMC) была проведена на тканях рака толстой кишки без ICB (MMR-d) у 17 пациентов из LUMC, из которых четыре HLA класса I положительные, восемь HLA класса I -дефект и пять β2m-дефектов (расширенная таблица данных 1).Кроме того, IMC был выполнен на обработанных ICB тканях рака толстой кишки (MMR-d) десяти пациентов из NKI, из которых пять B2M WT и пять B2M MUT . Конъюгацию антител и иммунодетекцию проводили в соответствии с методологией, опубликованной ранее Ijsselsteijn et al. 43 . Ткань FFPE размером 4 мкм инкубировали с 41 антителом в четыре этапа. Сначала срезы инкубировали с анти-CD4 и анти-TCRδ в течение ночи при комнатной температуре, которые затем выявляли с использованием вторичных антител, конъюгированных с металлом (козьи антикроличьи IgG и козьи антимышиные IgG соответственно; Abcam).Во-вторых, срезы инкубировали с 20 антителами (таблица расширенных данных 3) в течение пяти часов при комнатной температуре. В-третьих, срезы инкубировали в течение ночи при 4°C с оставшимися 19 антителами (таблица расширенных данных 3). В-четвертых, срезы инкубировали с 0,125 мкМ интеркалятора Cell-ID-Ir (Fluidigm) для обнаружения ДНК и хранили в сухом виде до измерения. Для каждого образца были отобраны шесть областей размером 1000×1000 мкм на основе последовательного окрашивания гематоксилином и эозином (H&E) и удалены с использованием системы Hyperion Imaging (Fluidigm).Данные были получены с помощью программного обеспечения CyTOF (версия 7.0) и экспортированы с помощью MCD Viewer (версия 1.0.5). Данные были нормализованы с использованием полуавтоматического удаления фона в ilastik 44 , версия 1.3.3, для контроля вариаций сигнал-шум между секциями FFPE, как описано ранее 45 . После этого данные фенотипа нормализовали на уровне пикселей. Маски сегментации клеток были созданы для всех CD3- и/или CD7-положительных клеток в ilastik и CellProfiler 46 , версия 2.2.0. В ImaCytE 47 версии 1.1.4 маски сегментации клеток и нормализованные изображения были объединены для создания файлов FCS для отдельных клеток, содержащих относительную частоту положительных пикселей для каждого маркера на клетку. Клетки, образующие визуальные окрестности в t-распределенном стохастическом встраивании соседей (t-SNE) 48 в Cytosplore 49 версии 2.3.0, были сгруппированы и экспортированы в виде отдельных файлов FCS. Полученные подмножества были импортированы обратно в ImaCyte и визуализированы на масках сегментации.Экспрессию иммуномодулирующих маркеров определяли во всех клетках с относительной частотой не менее 0,2 положительных пикселя на клетку. Различия в клетках/мм 2 рассчитывали по критерию Манна-Уитни в программе Graphpad Prism (версия 9.0.1). Таблица 3. Расширенные данные

    . Антитела, используемые для визуализации масс-цитометрии рака толстой кишки.

    Сортировка γδ Т-клеток рака толстой кишки и секвенирование РНК одиночных клеток ) для идентификатора образца и меток, полученных из антител (ADT) для экспрессии белков CD45RA и CD45RO, с помощью CITE-seq

    50 .Клетки оттаивали, выдерживали при 37°C в среде IMDM (Lonza)/20% FCS в течение 1 ч с последующей инкубацией с блоком Fc-рецепторов человека (BioLegend) в течение 10 мин при 4°C. После этого клетки окрашивали поверхностными антителами (1:50 анти-CD3-PE [клон SK7, BD Biosciences], 1:160 анти-CD45-PerCP-Cy5.5 [клон 2D1, eBioscience], 1:200 анти-CD45-PerCP-Cy5.5 [клон 2D1, eBiosciences]. CD7-APC [клон 124-1D1, eBioscience], 1:60 анти-EPCAM-FITC [клон HEA-125, Miltenyi], 1:80 анти-TCRγδ-BV421 [клон 11F2, BD Biosciences] и 1:1000 краситель жизнеспособности в ближней инфракрасной области спектра [Life Technologies]), 1 мкг антител TotalSeq-C против CD45RA (клон HI100, BioLegend) и 1 мкг антител против CD45RO (клон UCHL1, BioLegend) и 0.5 мкг уникального антитела с хэштегом TotalSeq-C CD298/β2M (клон LNH-94/2M2, BioLegend) для каждого образца (n=5) в течение 30 мин при 4°C. Клетки трижды промывали буфером FACS (PBS (Fresenius Kabi)/1% FCS) и хранили в холоде и темноте до сортировки клеток. Компенсацию проводили с помощью CompBeads (BD Biosciences) и реактивных шариков ArC (Life Technologies). Отдельные живые клетки CD45 + EPCAM CD3 + TCRγδ + из пяти колоректальных опухолей (MMR-d) сортировали на FACS Aria III 4L (BD Biosciences).После сортировки образцы были объединены. Библиотеки scRNA-seq

    были приготовлены с использованием набора реагентов Chromium Single Cell 5’ Reagent Kit v1 (10X Genomics) в соответствии с инструкциями производителя. Конструирование 5′-библиотек экспрессии генов позволило идентифицировать подмножества γδ Т-клеток в соответствии с использованием Vδ и Vγ. Библиотеки секвенировали на HiSeq X Ten с использованием парного секвенирования 2×150 п.н. (Illumina). Прочтения были сопоставлены с эталонным геномом человека (GRCh48) и количественно оценены с помощью Cell Ranger (версия 3.1.0). Последующий анализ выполняли с помощью Seurat (версия 3.1.5) в соответствии с инструкциями автора 51 . Вкратце, исключались клетки с менее чем 200 обнаруженными генами и гены, которые экспрессировались менее чем в шести клетках. Полученные 5669 клеток были демультиплексированы на основе обогащения HTO с использованием алгоритма MULTIseqDemux 52 .

    Затем из анализа были отфильтрованы клетки с содержанием митохондриальных генов более 10% и клетки с крайним числом экспрессированных генов (>3000), в результате чего был получен окончательный набор данных из 4442 клеток.Данные были нормализованы с использованием функции «LogNormalize» от Seurat с коэффициентом масштабирования 10 000. Переменные функции были идентифицированы с помощью функции «FindVariableFeatures» от Seurat, возвращающей 2000 функций. Затем мы применили функцию «RunFastMNN» из SeuratWrappers, разделенную по идентификатору образца, чтобы скорректировать потенциальные эффекты, полученные в пакетном режиме, для образцов 53 . Для визуализации ячеек в двумерном пространстве использовалась унифицированная многообразная аппроксимация (UMAP) 54 , за которой следовали функции «FindNeighbors» и «FindClusters» от Seurat.Данные были масштабированы, и неоднородность, связанная с митохондриальным загрязнением, была регрессирована. Кластеры клеток идентифицировали путем проведения анализа дифференциально экспрессируемых генов с помощью функции «FindAllMarkers» с min.pct и logfc.threshold на уровне 0,25. Процент TRDV1 (Vδ1), TRDV2 (Vδ2) или TRDV3 (Vδ3) положительных клеток определяли как процент всех клеток с уровнем экспрессии >1, в то время как <1 для других цепей TCR Vδ . CRC96, 134 и 167 имели менее десяти клеток TRDV3 + и не были включены в анализ Vδ3.Транскрипты клеток Vδ4 (TRDV4), Vδ5 (TRDV5), и Vδ8 (TRDV8) не обнаружены. Процент TRGV1 (Vγ1) – TRGV11 (Vγ11) положительных клеток определяли как процент всех клеток с уровнем экспрессии >1, а <1 для остальных Vγ-цепей TCR. Процент клеток, положительных по определенному гену, определяли как все клетки с уровнем экспрессии >1.

    Сортировка γδ Т-клеток рака толстой кишки и культивирование клеток

    γδ Т-клеток рака толстой кишки (MMR-d) пяти пациентов из LUMC были отсортированы для культивирования клеток.Клетки оттаивали и выдерживали при 37°C в IMDM (Lonza)/10% nHS в течение 1 часа. После этого клетки инкубировали с блоком Fc-рецепторов человека (BioLegend) и окрашивали поверхностными антителами (1:20 анти-CD3-Am Cyan [клон SK7, BD Biosciences], 1:80 анти-TCRγδ-BV421 [клон 11F2, BD Biosciences]. Biosciences] и 1:30 анти-PD-1-PE [клон MIh5, eBioscience] в течение 45 мин при 4°C вместе с различными дополнительными антителами для иммунофенотипирования (включая 1:10 анти-CD103-FITC [клон Ber-ACT8, BD Biosciences], 1:200 анти-CD38-PE-Cy7 [клон HIT2, eBioscience], 1:60 анти-CD39-APC [клон A1, BioLegend], 1:20 анти-CD45RA-PE-Dazzle594 [клон HI100, Sony], 1:20 анти-CD45RO-PerCP-Cy5.5 [клон UCHL1, Sony], 1:40 анти-TCRαβPE-Cy7 [клон IP26, BioLegend], 1:50 анти-TCRVδ1-FITC [клон TS8.2, Invitrogen] или 1:200 анти-TCRVδ2-PerCP- Cy5.5 [клон B6, BioLegend]. В каждое окрашивание был включен фиксируемый краситель жизнеспособности в ближней инфракрасной области спектра 1:1000 (Life Technologies). Клетки трижды промывали буфером FACS (PBS/1% FCS) и хранили в холоде и темноте до сортировки клеток. Компенсацию проводили с помощью CompBeads (BD Biosciences) и реактивных шариков ArC (Life Technologies). Отдельные живые клетки CD3 + TCRγδ + PD-1 + и PD-1 из пяти колоректальных опухолей (MMR-d) сортировали на FACS Aria III 4L (BD Biosciences).Для CRC94 все γδ Т-клетки были отсортированы из-за низкого количества клеток PD-1 + . γδ Т-клетки сортировали в среде, содержащей фидерные клетки (1×10 90 101 6 90 102 /мл), PHA (1 мкг/мл; Thermo Fisher Scientific), IL-2 (1000 МЕ/мл; Novartis), IL-15 (10 нг/мл, R&D Systems), гентамицин (50 мкг/мл) и фунгизон (0,5 мкг/мл). Отсортированные γδ Т-клетки размножались в присутствии 1000 МЕ/мл IL-2 и 10 нг/мл IL-15 в течение трех-четырех недель. Чистоту и фенотип γδ Т-клеток оценивали с помощью проточной цитометрии.Мы получили более чем 170 000-кратное увеличение за 3-4 недели размножения γδ Т-клеток (расширенные данные, рис. 4e).

    Иммунофенотипирование размноженных γδ Т-клеток с помощью проточной цитометрии

    Размноженные γδ Т-клетки из опухолей толстой кишки анализировали с помощью проточной цитометрии на экспрессию цепей TCR Vδ, рецепторов NKG2, NCR, KIR, тканевых маркеров резидентности/активации, цитотоксических молекул, молекулы иммунных контрольных точек, цитокиновые рецепторы и Fc-рецепторы. Вкратце, клетки инкубировали с блоком рецептора Fc человека (BioLegend) и окрашивали антителами клеточной поверхности (таблица расширенных данных 4) в течение 45 минут при 4°C с последующими тремя этапами промывки в буфере FACS (PBS/1% FCS).Гранзим В и перфорин определяли внутриклеточно с использованием буфера для фиксации и промывочного буфера для внутриклеточного окрашивания пермеабилизации (BioLegend). Компенсацию проводили с помощью CompBeads (BD Biosciences) и реактивных шариков ArC (Life Technologies). Клетки получали на FACS LSR Fortessa 4L (BD Biosciences) с программным обеспечением FACSDiva версии 9.0 (BD Biosciences). Данные анализировали с помощью программного обеспечения FlowJo версии 10.6.1 (Tree Star Inc).

    Расширенные данные. Таблица 4. Антитела, использованные для иммунофенотипирования γδ Т-клеток с помощью проточной цитометрии.

    Культура клеток линий раковых клеток

    Линии клеток колоректальной аденокарциномы человека HCT-15 (MMR-d), LoVo (MMR-d), HT-29 (MMRp), SW403 (MMR-p) и SK-CO-1 (MMR-p), а также линию клеток человеческого лейкоза с дефицитом HLA класса I K-562 и линию клеток лимфомы Беркитта Daudi использовали в качестве мишеней для анализов реактивности и уничтожения иммунных клеток. Клеточные линии были аутентифицированы с помощью профилирования STR и протестированы на наличие микоплазмы. Клетки HCT-15, LoVo, HT-29, K-562 и Daudi поддерживали в среде RPMI (Gibco)/10% FCS.SW403 и SK-CO-1 поддерживали в среде DMEM/F12 (Gibco)/10% FCS. Все прилипшие клеточные линии перед пассированием обрабатывали трипсином.

    Органоидные модели и культура

    Опухолевые органоиды были получены из опухоли MMR-d CRC двух пациентов путем резекции толстой кишки, опухолевого органоида 1, или биопсии брюшины, опухолевого органоида 2 (таблица расширенных данных 2). Выделение соответствующих линий органоидов из опухолевого материала проводили, как сообщалось ранее 55,56 . Вкратце, опухолевая ткань была механически диссоциирована и обработана 1.5 мг/мл коллагеназы II (Sigma-Aldrich), 10 мкг/мл гиалуронидазы типа IV (Sigma-Aldrich) и 10 мкМ Y-27632 (Sigma-Aldrich). Клетки заключали в Cultrex® RGF BME Type 2 (кат. № 3533-005-02, R&D systems) и помещали в инкубатор при 37°C на 20 мин. Органоидная среда CRC человека состоит из Ad-DF+++ (Advanced DMEM/F12 (GIBCO) с добавлением 2 мМ ультраглутамина I (Lonza), 10 мМ HEPES (GIBCO) и 100/100 ЕД/мл пенициллина/стрептомицина (GIBCO), 10 % среды, кондиционированной Noggin, 20% среды, кондиционированной R-spondin1, 1x добавка B27 без витамина A (GIBCO), 1.25 мМ нацетилцистеина (Sigma-Aldrich), 10 мМ никотинамида (Sigma-Aldrich), 50 нг/мл человеческого рекомбинантного EGF (Peprotech), 500 нМ A83-01 (Tocris), 3 мкМ SB202190 (Cayman Chemicals) и 10 нМ простагландина E2 (Кайман Кемикалс). Органоиды пассировали в зависимости от роста каждые 1–2 недели путем инкубации в TrypLE Express (Gibco) в течение 5–10 мин с последующим заливкой в ​​BME. Органоиды были аутентифицированы с помощью массива SNP или профиля STR и регулярно тестировались на микоплазму с использованием Mycoplasma PCR43 и набора для обнаружения микоплазмы MycoAlert (кат.LT07-318). В первые две недели органоидной культуры добавляли 1x Primocin (Invivogen) для предотвращения микробного загрязнения. Процедуры, проводимые с образцами пациентов, были одобрены Комитетом по медицинской этике Нидерландского института рака – больницы Антони ван Левенгук (исследование NL48824.031.14), и от всех пациентов было получено письменное информированное согласие. Статус репарации несоответствия оценивали по стандартному протоколу для автоматического иммунокрасителя Ventana для клона M1 MLh2 (Roche), клона MSh3 G219-1129 (Roche), клона MSH6 EP49 (Abcam) и клона PMS2 EP51 (Agilant Technologies).Линии опухолевых органоидов B2M KO были созданы с использованием sgRNA, нацеленной на B2M (GGCCGAGATGTCTCGCTCCG), клонированных в плазмиду LentiCRISPR v2. Вирус был получен стандартным методом.

    Скрининг

    линий раковых клеток и опухолевых органоидов с помощью проточной цитометрии

    Линии раковых клеток, используемые в анализах реактивности и уничтожения, подвергали скринингу на экспрессию молекул HLA класса I, лигандов NKG2D, лигандов DNAM-1 и бутирофилина с помощью проточной цитометрии.Вкратце, клетки инкубировали с блоком рецептора Fc человека (BioLegend) и окрашивали различными антителами клеточной поверхности (1:10 анти-CD112-PE [клон R2.525, BD Biosciences], 1:10 анти-CD155-PE [клон 300907, R&D Systems], 1:50 анти-CD277/BTN3A1-PE [клон BT3.1, Miltenyi], 1:100 анти-HLA-A,B,C-FITC [клон W6/32, eBioscience], 1: 20 анти-HLA-EBV421 [клон 3D12, BioLegend], 1:20 анти-HLA-G-APC [клон 87G, BioLegend], 1:300 анти-MICA/B-PE [клон 6D4, BioLegend], 1:10 анти-ULBP1-PE [клон 170818, R&D Systems], 1:20 анти-ULBP2/5/6-PE [клон 165903, R&D Systems], 1:20 анти-ULBP3-PE [клон 166510, R&D Systems], или 1:20 анти-ULBP4-PE [клон 709116, R&D Systems] в течение 45 мин при 4°C.В каждое окрашивание был включен фиксируемый краситель жизнеспособности в ближней инфракрасной области спектра 1:1000 (Life Technologies). Клетки трижды промывали буфером FACS (PBS/1% FCS). Компенсацию проводили с помощью CompBeads (BD Biosciences) и реактивных шариков ArC (Life Technologies). Клетки получали на FACS Canto II 3L или FACS LSR Fortessa 4L (BD Biosciences) с использованием программного обеспечения FACSDiva версии 9.0 (BD Biosciences). Контроль изотипа или FMO был включен для определения процента положительных раковых клеток.Данные анализировали с помощью программного обеспечения FlowJo версии 10.6.1 (Tree Star Inc).

    Для окрашивания поверхности органоидов опухолевые органоиды диссоциировали на отдельные клетки с помощью TrypLE Express (Gibco), дважды промывали холодным буфером FACS (PBS, 5 мМ EDTA, 1% бычьего сывороточного антигена) и окрашивали либо 1:20 анти-HLA- A,B,C-PE (клон W6/32, BD Biosciences), 1:100 анти-β2m-FITC (клон 2M2, BioLegend), 1:200 анти-PD-L1 (клон MIh2, eBioscience) и 1:2000 краситель для определения жизнеспособности в ближней инфракрасной области спектра (NIR) (Life Technologies) или изотипические контроли (FITC, PE или APC) мышиного IgG1 каппа (BD Biosciences).Для анализа экспрессии лиганда NKG2D клетки окрашивали 1:300 анти-MICA/MICB, 1:10 анти-ULBP1, 1:20 анти-ULBP2/5/6, 1:20 анти-ULBP3, 1:20 анти-ULBP4, и 1:2000 краситель жизнеспособности в ближней инфракрасной области спектра (NIR) (Life Technologies). Опухолевые клетки инкубировали 30 мин при 4°С в темноте и дважды промывали буфером FACS. Все образцы были записаны на Becton Dickinson Fortessa.

    Анализ реактивности γδ Т-клеток

    Реактивность γδ Т-клеток по отношению к различным линиям раковых клеток оценивали с помощью анализа реактивности совместного культивирования.γδ Т-клетки оттаивали и культивировали в среде IMDM+Glutamax (Gibco)/8% nHS с пеном (100 МЕ/мл)/стрептококком (100 мкг/мл) в присутствии низких доз ИЛ-2 (25 МЕ/мл). ) и IL-15 (5 нг/мл) в течение ночи при 37°C. Линии раковых клеток подсчитывали, доводили до концентрации 0,5×10 90 101 5 90 102 клеток/мл в среде IMDM+Glutamax/10% FCS с пеном (100 МЕ/мл)/стрептококком (100 мкг/мл) и высевали (100 мкг/мл). мкл/лунку) в покрытых 96-луночных плоскодонных микропланшетах (Greiner CellStar) (на 5000 клеток/лунку) в течение ночи при 37°C. На следующий день γδ Т-клетки собирали, подсчитывали и доводили до концентрации 1.2×10 6 клеток/мл в среде IMDM+Glutamax/10% FCS. γδ Т-клетки добавляли в 50 мкл (для 60 000 клеток/лунку) и совместно культивировали (соотношение E:T 12:1) при 37°C в течение 18 часов в биологических тройных повторах. Среду (без раковых клеток) использовали в качестве отрицательного контроля и РМА (20 нг/мл)/иономицин (1 мкг/мл) в качестве положительного контроля. После совместного культивирования супернатант собирали для определения секреции IFNγ с помощью ELISA (Mabtech) в соответствии с инструкциями производителя. Кроме того, клетки собирали, инкубировали с блоком Fc-рецепторов человека (BioLegend) и окрашивали антителами клеточной поверхности (1:100 анти-CD137-APC [клон 4B4-1, BD Biosciences], 1:150 анти-CD226/DNAM- 1-BV510 [клон DX11, BD Biosciences], 1:400 анти-CD3-AF700 [клон UCHT1, BD Biosciences], 1:80 анти-CD39-APC [клон A1, BioLegend], 1:10 анти-CD40L-PE [клон TRAP1, BD Biosciences] или 1:30 анти-PD-1-PE [клон MIh5, eBioscience], 1:40 анти-TCRγδ-BV650 [клон 11F2, BD Biosciences], 1:300 анти-NKG2D-PE- Cy7 [клон 1D11, BD Biosciences] и 1:20 анти-OX40-FITC [клон ACT35, BioLegend] в течение 45 мин при 4°C.В каждое окрашивание был включен фиксируемый краситель жизнеспособности в ближней инфракрасной области спектра 1:1000 (Life Technologies). Клетки трижды промывали буфером FACS (PBS/1% FCS). Компенсацию проводили с помощью CompBeads (BD Biosciences) и реактивных шариков ArC (Life Technologies). Клетки получали на FACS LSR Fortessa X-20 4L (BD Biosciences) с программным обеспечением FACSDiva версии 9.0 (BD Biosciences). Данные анализировали с помощью программного обеспечения FlowJo версии 10.6.1 (Tree Star Inc). Все данные являются репрезентативными как минимум для двух независимых экспериментов.

    Анализ уничтожения иммунных клеток γδ Т-клетки

    Уничтожение различных линий раковых клеток γδ Т-клетками визуализировали и количественно определяли с помощью анализа уничтожения иммунных клеток при совместном культивировании с использованием системы анализа живых клеток IncuCyte S3 (Essen Bioscience). Клетки HCT-15, LoVo и HT-29 трансдуцировали реагентом IncuCyte NucLight Red Lentivirus Reagent (EF-1α, Puro; Essen BioScience), обеспечивающим экспрессию красного (mKate2) флуоресцентного белка, ограниченного ядром. Короче говоря, HCT-15, LoVo и HT-29 были высеяны, трансдуцированы в соответствии с инструкциями производителя, и с использованием пуромициновой селекции были созданы стабильные клеточные популяции.Линии раковых клеток подсчитывали, доводили до концентрации 1×10 90 101 5 90 102 клеток/мл в среде IMDM+Глутамакс/10% FCS с пеном (100 МЕ/мл)/стрептококком (100 мкг/мл) и высевали (100 мкг/мл). мкл/лунку) в 96-луночных плоскодонных прозрачных микропланшетах (Greiner CellStar) (на 10 000 клеток/лунку). Планшет с клетками-мишенями помещали в систему IncuCyte при 37°C для мониторинга слияния клеток в течение 3 дней. На 2-й день γδ Т-клетки оттаивали и культивировали в среде IMDM+Glutamax/8% nHS с пеном (100 МЕ/мл)/стрептококком (100 мкг/мл) в присутствии низких доз ИЛ-2 (25 МЕ/мл). мл) и ИЛ-15 (5 нг/мл) в течение ночи при 37°С.На следующий день γδ Т-клетки собирали, подсчитывали и доводили до концентрации 7,2×10 90 101 5 90 102 клеток/мл в среде IMDM+Glutamax/10% FCS. После аспирации среды планшета с клетками-мишенями добавляли 100 мкл новой среды, содержащей 3,75 мкМ IncuCyte Caspase-3/7 Green Apoptosis Reagent (Essen BioScience) (1,5-кратная конечная концентрация анализа 2,5 мкМ), вместе с 50 мкл γδ Т-клетки (по 36 000 клеток/лунку). Их совместно культивировали (соотношение E:T 4:1) в системе IncuCyte при 37°C в биологических дубликатах.В качестве отрицательного контроля использовали только раковые клетки и только раковые клетки с каспазой-3/7. Изображения (2 изображения на лунку) снимались каждый час при 20-кратном увеличении с использованием фазового, зеленого и красного каналов в течение 4 дней.

    Анализ проводили в программе IncuCyte (версия 2020B) для каждой линии раковых клеток отдельно. Были применены следующие определения анализа: 1) для клеток HCT-15 в фазовом канале минимальная площадь 200 мкм 2 , в зеленом канале порог 2 GCU, а в красном канале порог 2 RCU, 2 ) для ячеек LoVo и HT-29 в фазовом канале минимальная площадь 200 мкм 2 , в зеленом канале порог 4 GCU, в красном канале порог 2 RCU.Затем в программном обеспечении IncuCyte количественно определяли апоптоз раковых клеток путем подсчета общего количества зеленых и красных объектов на изображении, нормализованного (путем деления) к общему количеству красных объектов на изображении после 12-часового совместного культивирования и отображаемого в процентах (среднее значение ± стандартная ошибка среднего). ) двух лунок с двумя изображениями/лунка.

    Анализ распознавания опухолевых органоидов

    Для оценки реактивности опухоли по отношению к органоидам B2M WT и B2M KO и условиям блокировки лиганда NKG2D опухолевые органоиды и γδ Т-клетки готовили, как описано ранее. 10,55,56 За два дня до эксперимента органоиды выделяли из BME путем инкубации в 2 мг/мл диспазы типа II (Sigma-Aldrich) в течение 15 мин перед добавлением 5 мМ этилендиаминтетрауксусной кислоты (ЭДТА) и промывали PBS. перед ресуспендированием в органоидной среде CRC с 10 мкМ Y-27632 (Sigma-Aldrich). Органоиды стимулировали 200 нг/мл IFNγ (Peprotech) за 24 часа до эксперимента. Для анализа распознавания и внутриклеточного окрашивания опухолевые органоиды диссоциировали на отдельные клетки и высевали в анти-CD28 (клон CD28.2 eBioscience) покрывали 96-луночные планшеты с U-образным дном γδ Т-клетками при соотношении мишень:эффектор 1:1 в присутствии 20 мкг/мл анти-PD-1 (Merus). В качестве положительного контроля γδ Т-клетки стимулировали 50 нг/мл форбол-12-миристата 13-ацетата (Sigma-Aldrich) и 1 мкг/мл иономицина (Sigma-Aldrich). Через 1 час инкубации при 37°C добавляли GolgiSTOP (BD Biosciences, 1:1500) и GolgiPlug (BD Biosciences, 1:1000). После 4 ч инкубации при 37°C γδ Т-клетки дважды промывали холодным буфером FACS (PBS, 5 мМ ЭДТА, 1% бычьего сывороточного антигена) и окрашивали 1:20 анти-CD3-PerCP-Cy5.5 (BD Biosciences), 1:20 анти-TCRγδ-PE (BD Bioscience), 1:20 анти-CD4-FITC (BD Bioscience) (не добавлялось в экспериментах с блокировкой лиганда NKG2D), 1:200 анти-CD8-BV421 (BD Biosciences) и краситель для определения жизнеспособности в ближней инфракрасной области (NIR) 1:2000 (Life Technologies) в течение 30 мин при 4°C. Клетки промывали, фиксировали и окрашивали анти-IFNγ-APC 1:40 (BD Biosciences) в течение 30 мин при 4°C с использованием набора Cytofix/Cytoperm (BD Biosciences). После двух этапов промывки клетки ресуспендировали в буфере FACS и регистрировали на проточном цитометре BD LSRFortessa™ Cell Analyzer SORP с FACSDiVa 8.0.2 (BD Biosciences).

    Эксперименты по блокированию с линиями раковых клеток и опухолевыми органоидами

    Реактивность и уничтожение γδ Т-клеток исследовали в присутствии различных блокирующих антител, чтобы выяснить, какие взаимодействия рецептор-лиганд задействованы. Для блокирования DNAM-1 γδ T-клетки инкубировали с 3 мкг/мл очищенного анти-DNAM-1 (клон DX11, BD Biosciences) в течение 1 часа при 37°C. Для блокирования TCR γδ Т-клетки γδ инкубировали с 3 мкг/мл очищенного анти-TCRγδ (клон 5A6.E9, Invitrogen) в течение 1 часа при 37°C, из которых клон, который мы использовали, был протестирован как лучший для использования в анализах блокирования γδ TCR 57 . Лиганды NKG2D блокировали на линиях раковых клеток и отдельных клетках опухолевых органоидов путем инкубации клеток-мишеней с 12 мкг/мл анти-MICA/B (клон 6D4, BioLegend), 1 мкг/мл анти-ULBP1 (клон 170818, R&D Systems ), 3 мкг/мл анти-ULBP2/5/6 (клон 165903, R&D Systems) и 6 мкг/мл анти-ULBP3 (клон 166510, R&D Systems) в течение 1 ч при 37°C перед посевом γδ Т-клеток.После инкубации с блокирующими антителами γδ Т-клетки добавляли к линиям раковых клеток HCT-15, LoVo и HT-29, как описано выше, с минимум двумя биологическими повторами на условие блокировки. Для экспериментов с органоидами во время инкубации добавляли 1:50 анти-CD107a-FITC (клон h5A3, BioLegend).

    В качестве контроля эффекторных функций антител, опосредованных Fc, только γδ Т-клетки инкубировали с блокирующими антителами в присутствии 2,5 мкМ IncuCyte Caspase-3/7 Green Apoptosis Reagent (Essen BioScience) в системе IncuCyte при 37°C , и количество апоптотических γδ Т-клеток определяли количественно с течением времени.

    Индекс

    дополнительной информации

    Расширенные данные Рис. 1. Ассоциация статуса мутации B2M с экспрессией αβ Т-клеточных рецепторов.

    Дополнительные данные Рис. 2. Характеристика γδ Т-клеток рака толстой кишки MMR-d с помощью scRNA-seq.

    Расширенные данные Рис. 3. Отдельные кластеры γδ Т-клеток из рака толстой кишки MMR-d с помощью scRNA-seq.

    Расширенные данные Рис. 4. Сортировка PD-1 + и PD-1 γδ Т-клеток от рака толстой кишки MMR-d с помощью FACS и использование их цепи TCR Vδ.

    Дополнительные данные Рис. 5. Реактивность γδ Т-клеток рака толстой кишки MMR-d по отношению к линиям раковых клеток.

    Дополнительные данные Рис. 6. Поверхностная экспрессия маркеров активации и секреция IFNγ при совместном культивировании γδ Т-клеток рака толстой кишки MMR-d с линиями раковых клеток.

    Расширенные данные Рис. 7. Характеристика опухолевых органоидов и результаты анализа реактивности.

    Расширенные данные Рис. 8. Поверхностная экспрессия активирующего рецептора NKG2D с помощью PD-1 + γδ Т-клеток из рака толстой кишки MMR-d при совместном культивировании с линиями раковых клеток.

    Расширенные данные Рис. 9. Уничтожение линий раковых клеток с помощью PD-1 + γδ Т-клеток из рака толстой кишки MMR-d в присутствии лиганда NKG2D, DNAM-1 или блокирования γδ TCR.

    Расширенные данные Рис. 10. Реактивность PD-1 + γδ Т-клеток в отношении линий раковых клеток из рака толстой кишки MMR-d в присутствии блокирующего лиганда NKG2D.

    Расширенные данные Рис. 11. Распределение популяций иммунных клеток в B2M — диком типе и B2M мутантном раке толстой кишки при ICB с помощью масс-цитометрии.

    Таблица расширенных данных 1. Характеристики клинических образцов от 17 пациентов с MMR-d раком толстой кишки.

    Расширенная таблица данных 2. Характеристики полученных от пациентов органоидов при MMR-d колоректальном раке.

    Расширенные данные Таблица 3. Антитела, используемые для визуализации масс-цитометрии рака толстой кишки.

    Расширенные данные Таблица 4. Антитела, используемые для иммунофенотипирования γδ Т-клеток методом проточной цитометрии.

    Фильм 1. Уничтожение клеток HCT-15 γδ Т-клетками (Vδ1 + ) при раке толстой кишки MMR-d.

    Фильм 2. Уничтожение клеток HCT-15 с помощью PD-1 + (Vδ1 + ) по сравнению с PD-1 рак.

    Drosophila brca2 необходима для репарации митотической и мейотической ДНК и эффективной активации контрольной точки мейотической рекомбинации

    Нулевые мутации у предполагаемой дрозофилы

    BRCA2 Гомолог, CG30169 , жизнеспособны

    Плохая консервативность последовательности гомологов BRCA2 за пределами повторов BRC и ДНК-связывающих доменов изначально препятствовала идентификации и изучению BRCA2 в низших модельных организмах.Однако, используя мотив последовательности, который описывает повторы BRC, Lo et al. (2003) идентифицировали предполагаемых гомологов у многих видов [15], включая некоторые, которые с тех пор были подтверждены как функциональные гомологи [16,17]. Было предсказано, что один ген дрозофилы, CG30169 , кодирует повторы BRC. CG30169 кодирует белок массой 109 кДа, содержащий 3 предполагаемых повтора BRC и 4 последовательности ядерной локализации. Примечательно, что в то время как Lo et al. (2003) предсказали ДНК-связывающие домены у позвоночных, растений и некоторых низших эукариот, они не обнаружили доказательств наличия ДНК-связывающего домена у CG30169 с помощью анализа последовательности.Следовательно, не было очевидным, что CG30169 кодирует функциональный гомолог BRCA2, поскольку известно, что экспрессия изолированных повторов преимущественно ингибирует Rad51-зависимую репарацию DSB, но слияния повтора BRC с репликационным белком А восстанавливают связывание ДНК и, следовательно, являются способен восстановить дефекты репарации мутантов BRCA2 [18–20].

    Чтобы определить, кодирует ли CG30169 функциональный гомолог BRCA2, и изучить его роль в реакциях на повреждение ДНК, мы внесли нулевые мутации в CG30169 . brca2 56E был создан путем неточного вырезания элемента P P{SUPor-P}CG30169 KG03961 , который вставлен в 5’UTR CG30169 . brca2 56E удаляет большую часть кодирующей последовательности CG30169 и часть 5’UTR соседнего гена CG4612 . brca2 KO был создан методом end-out гомологичной рекомбинации [21], и полученная хромосома полностью делетирована для CG30169 , но содержит полностью интактные соседние гены.Мы обнаружили, что гомозиготные комбинации brca2 KO , brca2 56E и трансгетерозиготные мутантные комбинации жизнеспособны, но рецессивны по женской стерильности.

    Гомолог

    BRCA2 необходим для гомологичной рекомбинационной репарации

    Лучше всего охарактеризована роль BRCA2 в регуляции рекомбиназы Rad51, которая, как было показано, необходима для репарации ДНК у дрозофилы [14]. Чтобы определить, представляет ли CG30169 функциональный гомолог BRCA2 , мы сначала проверили роль в репарации соматической ДНК, проанализировав чувствительность к мутагенам, метилметансульфонату (MMS) и рентгеновским лучам.Рентгеновское облучение (IR) приводит к целому ряду повреждений ДНК, включая большое количество DSB на протяжении клеточного цикла, в то время как MMS приводит к коллапсу репликационной вилки и образованию DSB, особенно во время S-фазы. Мы обнаружили, что, подобно мутантам rad51/spnA и rad54/okra ([14] и табл. 1 и 2), мутанты brca2 высокочувствительны как к MMS, так и к IR. Мух, гетерозиготных по любому аллелю brca2 , скрещивали вместе, личиночное потомство подвергали мутагенному воздействию и определяли процент гомозиготных мутантных мух, доживших до зрелого возраста, среди всех выживших взрослых особей.Мутанты brca2 показали полную или почти полную летальность после облучения 1250 рад ИК и 3-13-кратное снижение выживаемости после облучения 500 рад (таблица 1). Воздействие 0,08% MMS привело к 5–24-кратному снижению выживаемости мутантов brca2 (таблица 2). Мухи, дважды мутантные по бамии и brca2 , показали чувствительность к мутагенам, сравнимую с одиночными мутантами, предполагая, что два гена действуют одним и тем же путем. Сходная чувствительность к мутагенам между мутантами CG30169 , бамии и spnA предполагает, что CG30169 может быть функциональным гомологом BRCA2 , участвующим в репарации DSB.

    За репарацию DSB отвечает несколько путей, и выбор между этими путями является строго регулируемым процессом, на который влияют такие факторы, как природа разрыва или фаза клеточного цикла [22,23]. Известны три основных пути репарации DSB: негомологичное соединение концов (NHEJ), гомологичная рекомбинация (HR) и одноцепочечный отжиг (SSA) [4]. В NHEJ концы ДНК, фланкирующие разрыв, отжигаются, что приводит к вставке или удалению нескольких нуклеотидов в месте разрыва.Во время репарации SSA участки повторяющейся ДНК, окружающие DSB, отжигаются. Из-за высокой повторяемости эукариотических хромосом этот путь, вероятно, доступен для некоторых, но не для всех встречающихся в природе DSB. HR использует гомологичные последовательности гомологичной хромосомы или сестринской хроматиды в качестве шаблона для репарации. Если используется сестринская хроматида, HR не обладает мутагенными свойствами. Однако, если гомологичная хромосома является матрицей, может произойти потеря гетерозиготности. Было показано, что BRCA2 у других видов необходим для Rad51-зависимой репарации путем гомологичной рекомбинации, и были предложены другие роли в репарации ДНК [16,17,24].У C. elegans имеются in vitro и косвенные доказательства роли гомолога BRCA2 C. elegans BRCA2 в SSA [16, 25], хотя в исследованиях культур клеток млекопитающих с гипоморфными мутациями наблюдалось увеличение SSA [16, 25]. 26–29].

    Мы использовали анализ Repair Reporter 3 (Rr3) [30] для одновременного измерения относительных уровней восстановления HR, NHEJ и SSA в премейотической зародышевой линии отдельных самцов (рис. 1). Анализ Rr3 отслеживает восстановление DSB в эндонуклеазном сайте I-SceI, окруженном частичными копиями репортера dsRed. Существует тандемная дупликация dsRed из 147 пар оснований (п.н.), примыкающая к разрыву. I-SceI повсеместно экспрессируется в начале зиготической транскрипции, и результаты репарации DSB в мужской зародышевой линии можно наблюдать в потомстве (рис. 1А). Восстановление с помощью SSA воссоздает функциональную копию dsRed , и полученные мухи флуоресцируют красным цветом даже в отсутствие эндонуклеазы. Репарация с помощью NHEJ создает небольшие вставки или делеции в сайте I-SceI, и в результате мухи становятся темными даже в присутствии эндонуклеазы.Эти два класса были оценены из популяций с эндонуклеазой или без нее, чтобы отличить их от мух, несущих неразрезанный репортер, которые мозаично-красные и часто неотличимы от мух зародышевой линии DsRed [30]. Репарация с помощью HR с использованием сестринской хроматиды (HR-s) воссоздает репортер, который можно повторно разрезать до тех пор, пока не будет достигнут конечный результат. Репарация HR с использованием гомологичной хромосомы (HR-h) может происходить, когда на гомологичной хромосоме присутствует вариант Rr3, EJ1, который содержит мутированный сайт I-SceI.Репарация с помощью HR-h приводит к появлению темных мух даже при наличии эндонуклеазы, и ее можно отличить от NHEJ с помощью ПЦР, специфичной для мутированного сайта I-SceI.

    Рисунок 1. Мутации brca2 резко снижают репарацию HR-h, увеличивают репарацию SSA и приводят к повышенному образованию делеций

    премейотическая зародышевая линия самцов дрозофилы. Трансген Rr3 содержит сайт I-SceI, окруженный двумя частичными копиями dsRed .Одна копия dsRed содержит дупликацию 147 п.н. Восстановление с помощью SSA восстанавливает dsRed и приводит к образованию красного флуоресцентного потомства. Репарация с помощью NHEJ модифицирует сайт I-SceI и приводит к тому, что потомство становится темным независимо от присутствия эндонуклеазы. Трансген EJ1 представляет собой вариант Rr3, который имеет нефункциональный сайт I-SceI и делецию 16 п.н. на расстоянии 156 п.н. от сайта I-SceI. Потомство, полученное в результате репарации с помощью HR-h, также темное, даже если присутствует эндонуклеаза, и его можно отличить от NHEJ с помощью ПЦР.ПЦР-анализ также различает короткие и длинные тракты HR-h; HR-h с длинным трактом приводит к включению делеции в EJ1 и меньшего продукта. Делеции измеряют по потере маркера w + .

    (B) В скрещивании 2 присутствовала хромосома EJ1, и могла происходить репарация с помощью HR-h. Столбики погрешностей представляют собой стандартные ошибки между отдельными мужчинами; P -значения были рассчитаны с использованием перестановочного теста, описанного в [31]. Количество самцов/общее потомство, несущее Rr3, подсчитано для OreR, brca2 и бамии соответственно: 72/3861, 72/3163 и 78/3486.

    (C) В скрещивании 1 хромосома EJ1 отсутствовала, и репарация с помощью HR-h была недоступна. Количество самцов/общее потомство, несущее Rr3, подсчитано для OreR, brca2 и бамии соответственно: 66/7103, 67/6054 и 65/5546.

    a Класс делеции не был выделен до сортировки и поэтому представляет небольшую часть класса NHEJ.

    https://doi.org/10.1371/journal.pgen.0040031.g001

    Мы измерили два дополнительных параметра восстановления DSB.Во-первых, мы отслеживали степень конверсии гена слева от разрыва, определяя, включает ли репарированная хромосома делецию 16 п.н. на расстоянии 156 п.н. от DSB, которая была специфична для родительской хромосомы EJ1. Мы обозначаем репарированные хромосомы, содержащие делецию 16 п.н., как репарированные с помощью длинного пути HR-h. Репарация HR-h длинного пути, вероятно, представляет собой репарацию, при которой происходит повышенная конверсия генов из-за увеличения скорости синтеза ДНК после инвазии цепи или из-за увеличения резекции до синтеза ДНК.Альтернативно, изменения в репарации гетеродуплексной ДНК могут также влиять на наблюдаемый баланс продуктов репарации. Во-вторых, большие делеции слева от DSB приводят к потомству с белыми глазами из-за потери гена white , переносимого в трансгене Rr3. Мы провели анализ Rr3 с хромосомой EJ1 и без нее, чтобы измерить продукты репарации, когда репарация с помощью HR-h доступна и недоступна. Вся проверка гипотез проводилась с использованием значений P , полученных из тестов перестановки, описанных в [31], которые учитывают потенциальную кластеризацию результатов у одиноких мужчин из-за множественных сперматозоидов, полученных в результате одного события восстановления.

    В скрещивании 2, в котором присутствовала хромосома EJ1 и был доступен путь HR-h, мы наблюдали очень значительное снижение репарации HR-h у мутантов brca2 ( P <1e -8 ) (рис. 1B). ). ЧСС короткого тракта была снижена в 64 раза по сравнению со значениями дикого типа, а ЧСС длинного тракта была снижена в 9 раз. Эти значения, вероятно, занижают потребность в brca2 в HR-h. Из-за женской стерильности brca2 использование пути репарации было измерено у генетически нулевого потомства самок, гетерозиготных по brca2 , и низкие уровни белка Brca2 могли все еще присутствовать в начале зиготической транскрипции, когда эндонуклеаза была изначально выражено.Мы также наблюдали 5-кратное увеличение фланкирующих делеций у мутантов brca2 . Мы не наблюдали значительного увеличения числа делеций в скрещивании 1, в котором HR-h отсутствовал (рис. 1С). Таким образом, делеции, скорее всего, являются результатом аберрантной репарации HR-h, как ранее предполагалось для мутантов spnA и okra [32]. Мы не соблюдали требование для brca2 в SSA. Фактически, наблюдалось значительное увеличение SSA у мутантов brca2 как в скрещивании 1, так и в скрещивании 2 ( P =1.4e −7 и P <1,0e −8 соответственно, рис. 1B,C).

    Мы наблюдали значительные изменения SSA и NHEJ в кроссе 1, когда HR-h был недоступен ( P = 1,4 e -7 и P = 4,3 e -4 ) (рис. 1C). В скрещивании 1 использование SSA увеличилось до 111% от уровней дикого типа, а NHEJ снизилось до 74% процентов от уровней дикого типа у мутантов brca2 . Этот результат можно интерпретировать как частичное требование для brca2 в NHEJ.Однако в свете аналогичных результатов с другими дефектными мутантами HR-h [32], наших аналогичных результатов для мутантов бамии (рис. 1C) и того факта, что мы не наблюдали снижения NHEJ в скрещивании 2 ( P = 0,50, рис. 1В), мы склоняемся к объяснению, что изменения уровней NHEJ и SSA в кроссе 1 были вызваны дефектами HR-s, которые косвенно измерялись изменениями NHEJ и SSA. Несмотря на то, что HR-s не измеряли, репарация HR-s, вероятно, инициируется у мутантов brca2 . Если DSB, которые абортируют HR-s у мутантов brca2 и бамии в скрещивании 1, челночно перемещаются по пути SSA, как абортированные HR-h DSB у мутантов brca2 и бамии в скрещивании 2, то эффект будет заключаться в увеличении SSA по сравнению с NHEJ в скрещивании 1.Аналогичные аргументы были предложены для эффектов, наблюдаемых у мутантов spnA [32].

    В заключение мы обнаружили, что brca2 необходимы для HR-h и что потеря HR-h связана с увеличением использования восстановления SSA. Кроме того, скорость образования делеций вблизи DSB увеличивается у мутантов brca2 . Эти изменения в репарации DSB представляют собой сдвиг в сторону более мутагенной репарации DSB у мутантов brca2 , которые аналогичны изменениям, наблюдаемым у мутантов spnA/rad51 и okra/rad54 ([32] и Figure 1).Следовательно, мы не находим доказательств независимой от Rad51 роли Drosophila Brca2 в репарации соматической ДНК.

    Неспособность восстановить мейотические DSB в мутантах

    brca2 приводит к частичной активации контрольной точки мейотической рекомбинации

    Мутации в генах, необходимых для репарации мейотических DSB, таких как rad51/spnA, , вызывают бесплодие самок из-за активации контрольной точки мейоза, которая влияет на формирование дорсально-вентрального паттерна яичной скорлупы и эмбриона [1,14]. ДНК-эндонуклеаза Mei-W68 катализирует образование DSB в гермарии яичника дрозофилы как инициирующую стадию мейотической рекомбинации [33].Если DSB сохраняются, например, у мутантов репарации ДНК, активируется контрольная точка, что приводит к неэффективной трансляции Gurken, лиганда рецептора эпидермального фактора роста, ответственного за определение дорсальных судеб у эмбрионов дрозофилы и яичной скорлупы [1,34]. Активация контрольной точки мейотической рекомбинации приводит к вентрализации яиц, отложенных самками, мутантными по генам репарации мейотических DSB. Вторым характерным фенотипом активации контрольных точек является неспособность должным образом сформировать кариосому ядра ооцита.Эти дефекты могут быть подавлены мутациями в киназах, необходимых для трансдукции контрольных точек, что указывает на то, что они связаны с активностью контрольных точек [1]. Яйцевые камеры от мутантных самок brca 2 имели дефект кариосомы с высокой проникающей способностью (рис. 2А). Кроме того, мутантных самок brca2 из отложили слабовентрализованные яйца, которые не вылупились (рис. 2В и 2С). Паттерн яичной скорлупы и дефекты образования кариосом могут быть устранены с помощью одной копии спасательной геномной конструкции (рис. 2А и 2С).

    Рисунок 2. Стойкие двухцепочечные разрывы в brca2 Мутанты активируют контрольную точку мейотической рекомбинации

    (A) Яйцевые камеры, окрашенные на ДНК (зеленый) и мембраны (красный). Показанный процент представляет собой среднее количество сферических кариосом, подобных дикому типу, из двух независимых экспериментов, в которых было подсчитано в общей сложности 175–200 ядер. Вставка показывает область, содержащую ядро ​​ооцита.

    (B) Яичная скорлупа, отложенная самками дикого типа и brca2 KO/56 мутантными самками.

    (C) Частота откладывания яичной скорлупы разных классов самками, которых кормили дрожжами, в течение 3–4 дней. Яйца класса 1 имеют два отдельных дорсальных придатка и кажутся дикими по дорсальному рисунку. Яйца класса 2 имеют 2 спинных придатка, сросшихся у основания. Яйца класса 3 имеют один спинной придаток. Яйца класса 4 не имеют спинных придатков и представляют собой полную потерю спинной судьбы. Столбики погрешностей представляют собой стандартную ошибку между 3 независимыми экспериментами. Общее количество подсчитанных яиц на генотип составляло от 500 до 3000 яиц. P{CG30169}i23 и P{CG30169}i48 представляют собой спасательные геномные конструкции, вставленные в два разных участка хромосомы.

    https://doi.org/10.1371/journal.pgen.0040031.g002

    Для передачи сигнала контрольной точки мейотической рекомбинации требуется Hus1, член комплекса контрольной точки Rad9-Hus1-Rad1 (9-1-1), и киназы контрольных точек Mei-41/ATR и Chk2 [1,35,36]. Мутации либо mei-P22 , гена, необходимого для образования DSB [37], либо киназы контрольной точки chk2 подавляют дефекты яичной скорлупы и кариосом мутантов brca2 (рис. 2A и 2C), ясно демонстрируя, что фенотипы яичников наблюдаемые происходят из-за стойких DSB, которые активируют контрольную точку мейоза.Мы наблюдали незначительное или полное отсутствие подавления дефектов яичной скорлупы или кариосом у mei41 D3 ; brca2 KO/56 (рис. 2C) или mei41 29D ; brca2 KO/56 (данные не показаны) двойные мутанты. Это может быть связано с возможной избыточностью между двумя восходящими киназами контрольных точек Mei-41/ATR и ATM. В настоящее время невозможно проверить роль atm в контрольной точке мейотической рекомбинации, поскольку даже доступные гипоморфные, жизнеспособные atm мутанты имеют паттерн яичной скорлупы и дефекты кариосом ([38] и наши неопубликованные результаты).Дополнительные объяснения отсутствия подавления mei-41 фенотипа яичников brca2 представлены в Обсуждении. Тем не менее, подавление мутациями chk2 указывает на то, что фенотипы яичников мутантов brca2 являются результатом активации контрольной точки.

    Brca2 также необходим для эффективной активации контрольной точки мейотической рекомбинации

    Дефект паттерна яичной скорлупы brca2 является значительно более слабым дефектом, чем у любого из мутантов репарации мейотической ДНК, которые, как известно, активируют контрольную точку, spnA/rad51 , spnB/xrcc3 , spnC/hel308 , spnD/924 rad51C , или бамия / rad54 [14,39–41].Мы исследовали уровни γ-h3AV, маркера DSB, чтобы определить, было ли уменьшено количество DSB у мутантов brca2 по сравнению с другими мутантами мейотической репарации DSB или генами «класса веретена». У мух дикого типа очаги γ-h3AV видны в ядрах проооцитов в областях 2a и иногда 2b и отсутствуют в области 3 [42]. В среднем 14–15 очагов γ-h3AV присутствуют в ядре проооцита в области 2а, а затем уменьшаются в области 2b. Мутанты мейотической репарации ДНК обнаруживают задержку образования очагов γ-h3AV, но достигают пикового количества 20–24 очагов γ-h3AV в области 3 [42].Мутанты brca2 имели 19,2 очага γ-h3AV по сравнению с 21,1 очагами у мутантов spnA в области 3 (рис. 3А). Поэтому маловероятно, что слабый фенотип, наблюдаемый у мутантов brca2 , связан с уменьшением накопления персистентных DSB.

    Рисунок 3. Мутанты brca2 подавляют дефекты формирования паттерна мутантов репарации ДНК, которые активируют контрольную точку мейотической рекомбинации

    (A) Фокусы γ-h3AV (красный) в гермарии, ооцит в области 3 отмечен стрелкой.Про-ооциты отмечены окрашиванием C(3)G (синий). Изображения представляют собой проекцию стеков, взятых через всю Германию. Количество очагов γ-h3AV в области 3 представляет собой среднее число очагов +/- стандартная ошибка из общего числа 14, 14, 11, 7, 10 и 10 ооцитов области 3, подсчитанных для OreR, brca2, spnA, бамии, брка2; spnA, и brca2 бамии соответственно.

    (B) Частота откладывания яичной скорлупы разных классов самками, которых кормили дрожжами, в течение 5–7 дней. Классы показаны на рисунке 2.Обратите внимание на увеличение яичной скорлупы дикого типа (синяя) у двойных мутантов. Столбики погрешностей представляют собой стандартную ошибку между 3 независимыми экспериментами. Общее количество яиц по генотипу составило: 1149, 73, 1687, 456, 645, 1663, 922, 1199, 341, 339, 455, 268 и 196 соответственно.

    https://doi.org/10.1371/journal.pgen.0040031.g003

    Удивительно, но когда мы создали двойные мутанты с brca2 и любыми другими мутантами репарации мейотической ДНК, brca2 сильно подавили фенотип яичной скорлупы.Например, мутантные самки spnD откладывают 79,3% сильно вентрализованных яиц (яйца классов 3 и 4) и 13,8% яиц дикого типа (класс 1). брца2; Самки мутанта spnD откладывают 18,7% сильно вентрализованных яиц и 79,3% яиц дикого типа. Аналогичные результаты были получены с мутантами бамии и spnA (рис. 3В). Чтобы определить, было ли подавление фенотипа яичной скорлупы результатом усиленной репарации DSB у двойных мутантов, мы исследовали количество очагов γ-h3AV, присутствующих у двойных мутантов. spnA , бамия и двойные мутанты с brca2 имели сходные уровни очагов γ-h3AV в области 3 гермария (рис. 3А). Поэтому маловероятно, что повышенные уровни репарации происходят у двойных мутантов, и мы предполагаем, что Brca2 играет вторую роль в мейозе в передаче сигнала контрольной точки мейотической рекомбинации.

    brca2 и hus1 Не требуются для контрольных точек, реагирующих на радиационное повреждение

    Контрольные точки повреждения ДНК, которые реагируют на множественные типы повреждений и приводят к разнообразным ответам на повреждения, сходятся на общем наборе родственных трансдуцирующих киназ и медиаторных белков [43].Однако каждая контрольная точка имеет определенные генетические требования для передачи сигнала. Следовательно, мы посчитали возможным лучше понять, где в пути контрольных точек мейотической рекомбинации действует Brca2, изучив, требуются ли brca2 для др. контрольных точек Drosophila. Мы использовали хорошо зарекомендовавшие себя анализы в имагинальных дисках и мозге личинок дрозофилы для мониторинга контрольных точек, которые реагируют на облучение у животных, нулевых для brca2 . Облученные имагинальные диски демонстрируют остановку клеточного цикла G2 в течение 1 часа после облучения и вызывают апоптоз в течение 4 часов после облучения [44,45].Для индукции апоптоза необходимы chk2 и p53 , но не mei-41 или grp/chk1 [46]. Для остановки клеточного цикла после высокодозной ИК (4000 рад) требуется mei-41 , в меньшей степени chk2 и grp , но не атм [38,44,46]. Для остановки клеточного цикла после низкодозового ИИ (500 рад) требуется мей-41 , а также атм [47]. Зависимое от mei-41 снижение репликации или контрольная точка внутри S-фазы наблюдается в течение 2 часов после облучения в долях мозга личинок [48].

    Мы не обнаружили потребности в brca2 в контрольных точках, которые реагируют на облучение (рис. 4 и S1). После 4000 рад ИК-облучения мутантов brca2 продемонстрировали эффективную остановку G2 (рис. 4А) и индукцию апоптоза (рис. 4В). Остановка клеточного цикла после 500 рад ИК-облучения также не нарушалась у мутантов brca2 (рис. 4С). Мы не увидели никакой разницы между мутантами brca2 и личинками дикого типа в снижении окрашивания 5-бром-2-дезоксиуридином (BrdU) после воздействия 4000 рад (рис. 4D).Однако, в отличие от анализов клеточного цикла и апоптоза, в которых разница до и после облучения значительна, эффект контрольной точки внутри S представляет собой снижение уровня репликации чуть менее чем наполовину (рис. 4D). Поэтому мы не ожидаем, что сможем обнаружить частичные требования к генам, участвующим в контрольной точке внутри S-фазы. В совокупности контрольные точки облучения, которые мы тестировали, требовали атм , mei-41/atr , chk1 и chk2 и не требовали brca2 , демонстрируя, что активация основных контрольных точек преобразователей в ответ на них Дрозофила не нуждается в brca2 .

    Рисунок 4. brca2 Не требуется для контрольных точек, которые реагируют на повреждение облучением

    Лазающие личинки третьего возраста были облучены, а затем вскрыты перед фиксацией. Столбики погрешностей представляют собой стандартную ошибку из 6–10 образцов из 2–3 отдельных экспериментов. Репрезентативные изображения можно найти на рисунке S1.

    (A) Личинки были зафиксированы через 1 час после 4000 Рад ИК-облучения и окрашены на митотический маркер фосфогистона h4. п = 6,

    (B) Личинки были зафиксированы через 4 часа после ИК-облучения 4000 рад и окрашены на активированную каспазу-3.п = 6,

    (C) Личинки были зафиксированы через 1 час после ИК-облучения 500 рад и окрашены на митотический маркер фосфогистона h4. п = 11,

    (D) Личинки были инвертированы через 1,5 часа после ИК-облучения 4000 рад и инкубированы в среде Шнайдера с BrdU в течение 30 минут. п = 7–10.

    https://doi.org/10.1371/journal.pgen.0040031.g004

    В дополнение к тестированию потребности в brca2 на контрольно-пропускных пунктах мы также исследовали мутантов hus1 .Hus1 является членом комплекса 9-1-1, необходимого для активации контрольной точки мейотической рекомбинации Drosophila, и было показано, что он участвует в контрольных точках S-фазы у млекопитающих [36,49]. Подобно brca2 , hus1 не требуется для остановки клеточного цикла или индукции апоптоза после высокодозового IR у Drosophila [36]. В настоящем исследовании мы обнаружили, что hus1 также не требуются для контрольной точки G2/M после низкой дозы IR или контрольной точки intra-S (рис. 4C и 4D).Хотя мы наблюдали небольшое увеличение числа митотических ядер у мутантов hus1 по сравнению с диким типом после облучения в низких дозах, мы все еще наблюдаем 4-кратное уменьшение числа митотических клеток после ИК по сравнению с необлученными дисками, что указывает на что контрольная точка G2/M в значительной степени интактна у мутантов hus1 после IR низкой дозы.

    Добавить комментарий

    Ваш адрес email не будет опубликован.